domingo, 30 de abril de 2006

Este blogger me recuerda a...

Fle: las chapitas, el color verde, las galletas Príncipe (tu post sobre las galletas me marcó, tía), algunas tardes en las que me gustaría tomar algo mientras hablamos de chorradas varias y los claveles (ya sé que no te gustan, pero por eso mismo me recuerdan a ti jajaja).

Sly: los peluches (jaja no debiste decirlo), las camisetas de Metallica, mi acondicionador del pelo (me pregunto si debes usar para tu larga melena) y el tabasco (porque sé que te encanta el picante).

Bruja del norte: Bilbao (la ciudad donde vivía mi abuela), los donuts y el café (ya te dije que me encantan esas perlas de café que escribes).

FanMa: la decoración kitsch, Popland, las tapas, la música pop en español, Pizzicato Five y los viajes exóticos.

Marsonico: los collages que me hiciste de Madonna, una viaje a través de Estados Unidos (recuerda, primero SanFran y después en Las Vegas nos casamos), Chanel, los póster retro y no me preguntes porqué pero... “Los ángeles de Charlie”… será por la estética de la serie… no sé.

Masmi: cualquier grupo que no conozca y haga un concierto… y también me acuerdo de ti cuando me pongo a hacer fotos de todos los eventos a los que voy… ah y ese viaje tan chulo que hiciste por Croacia, esas fotos me encantaron y desde entonces me apetece mucho ir. Y los objetos o muebles con un toque retro.

Chopi: la juergas salvajes, Jack Daniel’s, el libro de “Historia de la psicología” que tengo (siempre pienso en que si tú me la contaras no me hubiera dado tanta pereza tener que estudiarla), los boquerones y cuando digo turbopop-piruleta.

Renko: camisetas de rayas (no preguntes, no sé porqué), las gafas de pasta negra, Ses Voltes y las fiestas improvisadas de disfraces.

Adhará: los Peta Zetas (jajaja cuando leí ese post tuyo sobre las trufas me hiciste recordar un montón de cosas), Ismael Serrano (que no me gusta, pero me recuerda a ti y a mi amigo Kaster) y… los goldfish (será por tu cibermascota).

Rakele: el Club de la Comedia (tu sarcasmo es genial), cuando abro mi cuenta de Gmail (fuiste tú quien me invitó) y los momentos cambiantes de humor.

Javier: la cerveza, el baloncesto, el Hogan’s y la canción “Free falling” de Tom Petty… Y te confieso que cuando veo algún anuncio de anti-arrugas masculino me pregunto si usas alguno porque me parece increíble lo monísimo que estás con la edad que dices tener jajjaja… Ah! Cuando miro mi nuevo mate, gracias.

Habibi: el libro que me enviaste (que me encanta, muchas gracias por el detalle), Londres, mis aburridas tardes en la inmobiliaria (que no lo eran tanto gracias a nuestros mails encadenados) y los caracoles.

Always: los
flequillos rectos, los pensamientos retorcidos (por eso de ir pensando una cosa que te lleva a otra y a otra y a otra y a otra) y fiestas en locales madrileños.

No hay orden, os he puesto así como me ha salido. Supongo que me he dejado a alguien en el tintero, cosa que no me puedo perdonar, así que os propongo algo: si véis que vuestro nombre no está aquí, dejadme un comment. Pero ante todo, siento mucho si no me he podido acordar de todos... que sois (afortunadamente) chorrocientos!!

Como regalito aquí os dejo a la doble oficial de la Chaqui. Son idénticas. Ni yo misma he podido encontrar las 7 diferencias... atentos al momento "metiroalsueloparajadearcomounaperra".

Cómo se os ha quedado el cuerpo??

viernes, 28 de abril de 2006

Y después de unas décadas...

... y a la espera de la confirmación oficial del segundo embombamiento de la Brinni (que no es por nada, pero yo ya baticiné) aquí tenemos a la nueva Mia Farrow, de cuando hizo "La semilla del diablo".


Y no es otra que Kylie Minogue, ya está haciendo sus primeras apariciones públicas con el look que hiciera famosa Mia cuando era la jovencísima esposa de Frank Sinatra.

Bueno, es un look como otro cualquiera. A mi personalmente me espanta, así que espero que Kylie recupere su estilismo de bajita-sexy y dejando a un lado el bottox, por favor.

Ah! y otra cosa: espero que no te vuelvas tan pessssssssada como Anastacia con su ya superado-hace-tiempos-ha cáncer de pecho. Es como la Rocío Jurado de los Esteits!! Que yo no digo que no se le tenga que dar importancia, pero jamía, hay, por desgracia, un montón (y los que no saben que lo tienen) de gente enferma de cáncer y no van por ahí en plan víctima, pobre-yo-cómprame-un-disco.

A parte de esto, vía Always Candy, me he enterado que han detenido a la suegra de Jesulín. Uséase, a madre de la MariCampa. Y todo por el chanchullo de las jubilaciones!! Jur jur jur!! Cómo me gustaría ser amiga de Jorge Javier Vázquez en estos momentos!!

Para terminar, os acordáis de un anuncio de un desodorante que tenía un slogan muy famoso que decía algo así como... "cuando un desconocido te regala flores y tal y tal".

Bien, pues ayer entró un total desconocido para mí y me regaló esto:

Y mientras hacía inventario, entre ayer y hoy...

... como estoy al lado de un súper ventanal, las flores se han puesto así de bonitas:

Tengo que decir que para mí es un desconocido, pero para mis compañeras es... un tío que de vez en cuando entra y nos da flores de su jardín. Cómo lo véis?

Escuchando: Rolling Stones - Simpathy for the devil... para ir poniéndome a tono que el mes que viene los veo en Barcelona. Fle, exijo un café!!

miércoles, 26 de abril de 2006

Hoy...

... he pensado dos cosas:

  1. Si se produjera una gran nube de polvo que tapara la luz del sol... tan espesa que pareciera que viviéramos en un enterno día nublado... cuánto tiempo tardaría en agotarse el oxígeno del planeta?
  2. Que no te echo de menos. Es cierto! No, ya no te echo de menos. Sí... a ti. Sabes perfectamente que hablo de ti. Ya no te echo de menos. A ti, a tu persona, a lo que tú me recordabas... no lo echo de menos... y creo que estoy mejor así.

Eso es todo.

Vaya! Me pisaron la idea!!


Qué fuerte me parece!! Yo que me había currado los cartelitos para el bebé de la
Güini, de TomKat, Brooke Shields... había recaudado algo de calderilla, pero claro, lo mejor era para el bebé de Brangelina. Necesitaba (y aún necesito) la pasta para procurarme una vivienda. Es que lo del "dame aaaaaaaaarrrrgo" está muy visto y al precio en el que están los estudios de 15 metros cuadrados con baño compartido... jamemaaaaaaaaten!

Se me ocurrió durante el embarazo de
Brinni y cuando hubo rumores de un segundo retoño de los Spiderline me dije yo a mí mismamente: "Tate, esta es la tuya chata!!". Pero resulta que los rumores más falsos que las tetas de Yola Berrocal (que, por cierto, la vi el otro día en Salsa Rosa de rubio... osssshhh, qué cosa más fea de ver!!).

Pero menos mal que mi mente retorcidamente privilegiada también ha ideado cartelitos para los bebés de la hermana de mi adorado
Jake Gyllenhaal, Maggie, y el más molón de todos los bebés: el baby-rocker de Gwen Stefani y Gavin Rossdale.

A ver si
MariViki en otro intento de retener a Deivi le pega por ir a por la niña (cómo la llamarían? Si el último es Cruz, la niña Escapulario, por eso de ser originales, no?) y... me forrrrrrro! Qué digo? Me alicato!!

Hala, ahí os dejo, que voy a ir reservando mi sitio en la acera más transitada de mi ciudad. Y nada de ropa vieja y sucia: divinadelamuertelenta, ante todo imagen.

Bueno, si al final no me llega para la entrada de un mini-cuchitril... al menos espero que sea suficiente para algún concierto de
Pearl Jam!!! Qué emoción!!!

Escuchando: Adema - Trust (siiiiiiiií, me he traido mis propios cedeses con emepetreses!!)

martes, 25 de abril de 2006

Un libro, una rosa.



Gracias Habibi por el libro maravilloso que me has regalado.

La casualidad... el destino... el sexto sentido... lo que sea, ha hecho que abra el libro por la página 30. El título del texto es Un tren vestido de rojo... y era tuyo!! Ha sido muy especial.

Con esta rosa te digo lo mismo que en tu nota: me alegro muchísimo de haberte ciber-conocido. Espero que algún día pueda quitar el "ciber".

Muchos, muchos besos! Gracias!

No, no, que yo no tengo cabeza, tengo un melón.

Que me voy al trabajo... te llamo cuando salga... me voy, me voy que tengo hora en el médico... qué?... sí, te acompaño, no hay problema... vaya, las 18:30 horas... gasolina, tengo que poner gasolina... Ay mi madre que tengo que ir a Correos!!... Diooooooorrrrrrrr, no hay un puto sitio libre??... que sólo quiero recoger una puñetera carta certificadaaaaaaaaaa!!

Arf, arf... corre, corre que encima la vieja esa se va a colar con todo el morro por eso de que está medio senil! Ja! Mucha senilidad y luego no se pierden ni un detalle de los culebrones... Hop! Esta soy!!.... Rrrrrrrrrrápido, vengo a buscar esta carta certificada... tic-ta-tic-tac... cómo mola ser funcionario!!

19:45... pero... qué cojones es esto? Una puta carta certificada para informarme de que soy una clienta estupenda y que me obsequian con... UN PUTO BOLI DE PLÁSTICO GUARRINDONGO??? Casi me muero del síncope pensando que era una multa... una orden de... yo qué sé... de algo??

Josputa que sois!!

Por favorrrrrr, que aún no he llamado... venga, venga que en un salgo estás en casa, te incrustas en el sofá y a tirar de móvil.

Sí?... en el coche... síiiiiiiiiii mamá, tengo el manos libres puesto... Ahora?... vale, vale... que síiiiiiiii: leche, yogures y ese-detergente-que-no-es-gel-pero-que-hace-espuma... no, no me olvido tampoco del champú-de-bote-verde.

Arf, arf, arf.... aaaaaaaaarrrrrffffff... me pregunto para qué necesitará 12 paquetes de 6 hamburguesas, 1 bote de lejía y 1 alcachofa... por favorrrrrrrrr, que me quiero ir a mi casa de una puñetera vez señorito-cajero!! Cómo puede tardar tanto en cobrar una miserable barra de pan??... es cierto... si dejarás de ligar co la tía de los putos patines de mierrrrrrrrrrda... joder, qué ordinaria me vuelvo cuando me cabreo!

Hora de llegada a casa? Las 20:30.

Y así todas las veces que le he dicho a mi Xurri que la llamaría y al final por pitos o flautas, por H o por B me he acordado cuando ya estaba en la cama. Ayer se mosqueó, con razón, conmigo.

Entoné el mea culpa pero... lo siento.

Soy súper despistada.
Sly me ha dicho si hacen bolsos de estos más monos, que me lo vaya pensando. Se me va la pinza y aunque no hago las cosas intencionadamente, tengo que volver a mi organización abandonada.

Me siento tan mal por lo de mi Xurri!! Espero que se arregle...

domingo, 23 de abril de 2006

Lo que tengo que aguantar.

Hoy he estado viendo la esssssssstupenda carrera en Ímola, donde mi querido Aloooonsooooooo, Alooooonso, ha quedado segundo, detrás de Xumi. Que todo sea dicho, para una carrera que gana el pobrecico... la que se ha montao!! Qué emocionante: se repitió el mismo duelo que el año pasado, sólo que por aquellos entonces era Xumi el que intentaba adelantar.

Aún así, tengo que decirte Xumi, muy a TU pesar, el pequeño asturiano de cuello ancho (y que me pone, osea, me pone tanto como para dejar de ser asssssessssssuarrrrrrrr) sigue siendo el líder del mundial. Queda mucho mundial aún, pero es que no me puede defraudar. No, lo siento. Se lo tengo prohibido: esa panda de descerebrados millonarios merengones (que encima llega a perder contra el Málaga, yo me hago
Hare Krisna y el look cabeza rapada no me sienta bien) se niega a dar ejemplo en el fútbol, alguien tiene que darme alguna alegría.

Sí cari, te ha tocado a ti, porque
Robbie tiene la agenda muy apretada y George está paseando al cerdito vietnamita. Ea, lo siento, es lo que hay.

Pero lo que de verdad me tiene indignada... ooooooossssssssshhhhh, que me pongo malísima sólo de pensarlo otra vez.

Conversación de hace unos días con señora de magnífico collar de perlas negras (no sé si eran de verdad o no, pero no podía dejar de mirarlas... pa mí que era de las buenas). La llamaré "la perlada".

La perlada: "Ay niña pero qué grande estás ya!! Pero si yo te conozco desde que eras un bebé... de verdad cómo pasa el tiempo"

SSG: "Pues sí, pues sí" (sonrisa tipo noaguantomás)

La perlada: "Ya me ha dicho tu madre que estudias y trabajas y tienes tu coche y que te gusta cocinar... y coser? sabes coser?"

SSG: "Lo qué?"

La perlada: "Nena, coser! Que tendrás que coserle los botones a las camisas de tu marido!! jisjisjis. Estas chicas de hoy en día, que se piensan que usando un ordenador de esos ya les soluciona la vida. Pero eso no es lo que les gusta a los hombres cuando llegan casa" (pero qué cruel!! con el miedo que me dan las agujas!!)

SuperSonicMom borra la sonrisa de su semblante y dirige su mirada de preocupación hacia mi persona. Con esa mirada también me está suplicando que sonría... por favor.

SSG: "perdone que la disculpe... el qué a quién tengo yo que coserle?" (rassssssssss, rasssssssss, rassssssss, es el sonido de mis uñas cuando las estoy afilando)

La perlada: "A tu marido!! Que en nada estás en los 30 y es una edad muy mala para una mujer. Aprovecha ahora que lo tienes todo en tu sitio"

SuperSonicMom (SSM): "Pues claro, claro mujer, pero los tiempos han cambiado. Si ahora no hace falta tener novio para..." (mientras me sigue suplicando con la mirada)

SSG: "Para nada, no me hace falta el novio para nada! El día que quiera morir lentamente no fumaré, me buscaré un novio!!... coser, coser... lo que tendría que coserle es la bo..."

SSM: "Hay que ver cómo se ha puesto la tarde, que parece que va a llover..." (Ayyyyyyy, por qué leches me pellizca?)

La perlada: "Lo que yo te diga, es lo que le digo todos los días a mi hijo. Que se deje de chicas independientes, que lo que necesita es una mujer que le tenga limpia la casa y que no se pase por ahí las horas muertas en una oficina. A dónde va a ir el país! En mis tiempo a su edad yo ya tenía a mis 2 hijos y en camino que venía la pequeña. Que a ver cuándo le das una alegría a tus padres y les haces abuelos. Que ya me ha dicho tu madre que tu prima ya ha tenido el niño. Tú lo que tienes que hacer..." (no sé si sabe que el chico con el que vive su hijo no sólo comparte el piso con él, mmmm, se lo digo?)

Rrrrraaaaaaaasssssssssssss... rrrrrrrraaaaaaaaaasssssssss...

SSG: "Mmmmm... yo es que tengo prisa y me voy a ir yendo mayormente... grrrrrrr"

La perlada (incansable la japuta): "Tan pronto? De verdad, si es que con tantas prisas que tenéis así no os dura el novio. Ayyyyyyyyy... con lo maja que eres, y que me ha dicho tu madre que cocinas y todo... nena!! que se te va a pasar el arroz!! Que no te va a dar tiempo a tener hijos?"

SSG: "Estooooooo... perdóneme usted que la disculpe otra vez... mire... a mí es que el tener novio o no me importa tanto como la rapidez de reproducción de las pulgas de agua. Lo de los niños, se lo vamos dejando a quien quiera tenerlos más que nada porque ni estoy por la labor, ni me gustan, ni los aguanto, niná dená. Pues nada, aquí la dejo con mi madre, que le vaya explicando lo mucho que me gusta salir, las horas a las que llego a casa, los escotes que me pongo y que soy fan del amor libre. Hala... con Dior! - sonrisa tipo
Grinch - Hasta luego mami!"

SSM: "Hasta luego tesoro" (sí, sí, nenis, mi madre aún osa a llamarme de esa manera en público)

La perlada: "..........."

Pero qué cabrona!! Luego dicen que lo de
Bridget Jones es una fantasía!! Pero por favor!! Esto es un intento de acoso y derribo en toda regla!!

Coser las camisas de mi marido... p'habennoh matao!! La hubiera estrangulado allí mismo con el puto collar de perlas. Y luego me lo hubiera llevado porque me encantan las perlas negras. Me pirrrrrrran las
perlas negras.

A todo esto: he vuelto a ser tía de estas monadas!!






Aquí estoy con la única niña de los seis cachorros. Más buena...

Por cierto... que también dejaría de ser asssssessssusarrrrr pecadora de la pradeeeeeeeera por Bono, que me pone incluso rebozao en chocolate con crispis y olé!

Antes de irme, resultados de la encuenta.

sábado, 22 de abril de 2006

jueves, 20 de abril de 2006

Basssssssssssta ya!

  1. Joder! La que se ha liado porque tengo las "caderas promientes"!!
  2. La moderación va a seguir, simplemente porque así lo he decidido.
  3. No va a ser para siempre.
  4. Y ya está.

Una vez expuestos estos sencillos puntos, quería introduciros en el maravilloso mundo de la colección de Lorenzos. Uséase, mi colección de soletes. Sólo he hecho fotos de algunos de ellos. Tengo bastantes, pero por cuestiones de espacio están bien guardaditos... hasta que tenga el equivalente al Taj Mahal para colocarlos jejeje.

Es el mejor momento, después de mi intento frustrado de cambiar el atuendo principal a mi perfil... o lo que sea.

En fin, comienzo:


De izquierda a derecha hay un sol de resina que pinté yo misma (querría haberlo pintado con naranjas y rojos pero es que justamente eran los colores que mi madre no tenía, así que bienvenidos el beige y el rosa), mi lámpara de noche y un marco que me regaló mi mami. Como no encontré ninguna foto de mi familia... quicir... que no fuera de la era cuaternaria... recorté ese sol de una revista y se quedará ahí hasta que tenga una foto digna.


De arriba a abajo: un sol un poco hermafrodita que mi madre me regaló porque le dio la gana y unas láminas también made in my madre (sí, muchas "piezas" de mi colección son generosas aportaciones de mi progenitora)


Ese sol de hierro forjado en realidad es un candelabro, pero claro, como soy taaaaaaaaan alta... pues eso, que con el tiempo lo convertiré en aplique, con bombilla y todo, cuidadín!! El cojín lo bordó mi mamá. Si es que es más apañá... y anda que no lo tiene fácil en mis cumples!


Eso de ahí arriba en realidad es un sello. Un súper-sello. Es grandecito. Por la parte de atrás está el mismo sol en goma, sólo hay que aplicarle la tinta. Pero aún no lo he usado. Fue un regalo de mierdanavidá de mi hermano.

Lo de abajo es el típico espejo sol-luna, peeeeeeeeeeeero hecho por mi tío, el hermano menor de mi madre (por favor, no fijarse en el chungo-pato, un capricho de mi madre)


Vale, eso dorado de ahí es una guirnalda de soles, estrellas y lunas. Sí, muy cósmica (como la sentadilla de la pseudo-Maddy jojojo). Lo siguiente es una tarjeta de cumpleaños de mi familia y por último, las llaves de mi... ejem... la casa donde mis amantes padres me permiten ver la vida pasar.


Ayomá!! Vaya historia tiene lo primero!! Lo dibujé cuando tenía 14 años o así. No me dejaban pintar mi cuarto de otro color que no fuera el blanco. Por entonces esa tapa-tapa-cables estaba oculta detrás de mi cama. Así que... una de esas noches cuando todavía no salía... jejeje... lo dibujé y nadie se dio cuenta... hasta que cambiamos los muebles de sitio (uns 4 años después). No es una obra de arte, pero lo he dejado como recuerdo.

Lo de abajo fue un regalo de un troglodita con el que salí. Por aquellos entonces la cosa ya estaba en pleno proceso cuesta abajo y sin frenos. Pero eso no va a impedir que me parezca precioso.

Hasta aquí los soles visibles de mi mini-reino.

Ah! Que no se me olvide!!


Este es el mate con su correspondiente bombilla que me trajo Javier de su tierra natal. Era de verdad! jajajajaja. Que no se me había olvidado. Muchas gracias Sr de Martino por su detalla para/con servidora.

Escuchando: Gorillaz - It's dare

pd: a escasas 300 visitas para llegar a las 40.000... qué emoción!!

Hostilidades, el señor Lorenzo y la anti-cristo.

El día de hoy ha amanecido nublado en la isla. Al menos en la parte en la que yo trabajo! No me importa mucho porque tengo un gran ventanal aquí al ladito y cuando al señor Lorenzo le da por aparecer, es como si tuviera una gran lupa apuntando al lado derecho de mi cara.

En fin. No es que me esté quejando, aunque le tengo mucho aprecio al astro rey. Tanto, tantísimo, que lo llevo tatuado. Tanto que lo colecciono: en postales, en figuras, en dibujos, en colgantes, en algún llavero... a la mayoría le suele gustar más la luna, incluso conozco a una chica que le encantan los corazones. A mí me gusta el sol.

Si no os habéis dado cuenta (como Masmi), he cambiado la foto de mi perfil. Va a parecer un poco oportunista, ahora digo porqué, pero la verdad es que llevaba mucho tiempo pensándolo.

Como ya existe un mini-banner o botón con esa foto, me parecía un poco repetitivo tener esa foto en el perfil y luego más abajo en el botón. Tenía varios modelos de soles para poner y ayer por fin me decidí. Pero gracias a un “anonymous” y su acertado comentario sobre mis caderas, va a parecer que lo hago por eso.

Pues bien, querido o querida “anonymous”, la verdad es que la suda lo que te parezca esa foto. A mí me gusta. Le tengo mucho cariño. Me la hicieron en una sesión improvisada de un curso de fotografía que hice dos años atrás. Así que evidentemente, si yo no soy perfecta, la foto tampoco puede salir si todos éramos aficionados y era la primera foto que yo revelaba.

Y sí, tengo unas “prominentes caderas”. Y lo cierto es que también me la trae floja si has leído o no otras veces mi blog. Si lo hubieras hecho sabrías que soy la primera que ha dicho que no soy una súper-mega-top-model (me faltan entre 25 y 30 cm de altura jajaja)

Pero en fin, lo que realmente me preocupa es que debes tener problemas de visión: la foto es en blanco y negro, no en sepia. Yo, en tu lugar, me lo haría mirar. Se empieza así y luego no distingues el rojo del verde. No te digo más.

Qué más? Oh sí! Los poros de mi piel. No los habrás confundido con LUNARES?? Defectos del revelado?? En serio, es un consejo: VE AL PUTO OCULISTA!! Y cuando tengas algo interesante que contar, no te reprimas. Pero por favor, que sea algo que no sepa, vale?

Además, que sean mis querido habituales y habitualas los que decidan qué foto prefieren en el perfil. Por mi parte, me da lo mismo una que otra :-) Confío en vuestro criterio.

Vaya! Parece que Lorenzo se está medio dejando ver. Pobre... si es que a él tampoco le debe gustar madrugar.

Ah!!... Katie esquizosonrisa Holmes ya ha explotado!! El anti-cristo ya está aquí... y es una niña!! Con la mala leche que gastamos las mujeres... y más esta pobrecita con el padre que le ha tocado!!

La pregunta es: cuánto tardará esta reciente mamá en quedarse como antes?? La cienciología permitirá las liposucciones?? Como reniegan de los antidepresivos... verdad Tomto?

Escuchando: no tengo ni idea... sólo sé que es una pesadilla auditiva cortesía al canal 40 Criminales latino.
************************************
Actualización, 15:10.
He vuelto a poner la foto original. Qué coño!! Quería cambiar la foto pero por mis ovarios se queda la original, a quien no le guste que no mire y punto pelota.

martes, 18 de abril de 2006

Que lo tiro señores, estoy que lo tirooooooooo!!

Más que nada porque “One” de mis adorados U2 ha sido elegida la mejor canción por delante de los Beatles, según la VH1 (donde también se hacen eco de la peli que han hecho sobre la reina de las pin up, Bettie Page a la cual adoro y admiro). Y no es por nada, pero de todas las canciones, era la mejor, aunque como segunda canción yo hubiera puesto la de Bob Marley, “Redemption song” (que quedó tercera) y después la de Nirvana, “Smells like teen spirit”.

Ni qué decir tiene que no sé qué cojones hace por ahí una canción de Coldplay, “Yellow”. Pero bueno, supongo que de todo tiene que haber... hay a quien le gusta Camela... por qué no le va a gustar a la gente el grupo del chico-tirita?

Por otro lado... pues no tengo mucho más que contar ya que estos 5 días de libranza no he hecho absolutamente nada útil ni provechoso. Lo que se dice no dar un palo al agua básicamente.

Bueno sí. El sábado fui de candelabra a una cena. Bueno, candelabra lo que se dice candelabra propiamente no. Es que mi amiga Lía estaba invitada a una cena donde se entregaban los premios de una liga de billar. Y claro, como no conocía a nadie, excepto a quien la había invitado... ahí que va Mara para hacer bulto jajaja.

El evento en sí no estuvo mal, pero ojalá hubiera podido retransmitir la crónica sobre la vestimenta en directo. No pude evitar poner motes a varios asistentes, como por ejemplo, la “no con esos zapatos”, la “los pantalones arremangaos no son piratas”... el “compro donde el Neng”... la “ medias blancas y zuecos no es una gran combinación” o el famoso “para uno que es decente y tiene novia joder”.

Me retiré pronto. Esta tos que no me abandona y el humo reinante gracias a esos irrespetuosos de mis pulmones no me permitían disfrutar más de la noche. Cuando digo pronto significa que llegué a casa antes de la 1:30.

El domingo otra cenita, pero de barbacoa... claro que antes de eso di más vueltas que un tonto gracias a las indicaciones, si se les puede llamar así, de Vanesa. Recordad: nunca dejéis que alguien que se ha bebido 5 cubatas en 3 horas os indique el camino... ni siquiera si es hacia el cuarto de baño.

También me retiré pronto. No soy muy compatible con el campo.

Y ayer pues fui a tomar algo con mi amiga Lía otra vez y luego vino
Javier. Y sí, esta vez se acordó de traer el regalito que tenía para mí jiji.

En no sé qué post de no sé cuándo puse que había perdido la bombilla de mi mate... y él se acordó!! Me trajo un pequeño mate con su bombilla, recuerdo de Santa Teresita. Qué monada! Luego pondré una foto para que lo podáis ver.

Así que desde las 19 hasta las 22 ahí estuvimos de palique. Lía se fue, vino Vanesa con un amigo, se fue... volvió... entretenida estuvo la tarde en Hogan’s.

Poco más puedo contar. No he tocado ni un libro, ni un folio, ni un boli... niná de na. Soy una perraca, lo reconozco.
Escuchando: Hoobastank - The reason.

lunes, 17 de abril de 2006

Hoy: te acuerdas?

Me encantan los anuncios. Por favor, qué bueno era este anuncio!! Quién no se acuerda de... GUEROPPAAAAAAA!!



Y quién no recuerda el mágico... GUASSSSSSSSSSSSSSSSSSAP!! jajaja. Diorrrrrr, si hasta me hice una camiseta con los caretos de estos tíos!! Qué grande es la publicidad!!




Dicen que segundas partes nunca fueron buenas. Bien, yo digo que "Terminator II" fue algo grande... y lo de la Budweiser más!!


La versión... "estoyconlachurri"


Y la apoteosis, mi versión favorita, la de wassssssaaaaaaaaaaaaabi!!



Versión evolucionada del anuncio:


Pues claro nenis! La versión Pokemon. Porque todos sabemos lo que es un bicho de esos. Un Pokemon es algo que... tiende a evolucionar!! Si es que está clarísimo!!.



Versión güey para los yankis, a ver si se apuntan a clases inglés jojojo. No os perdáis la versión geriátrico. Y ya, el acabose... HASTA LOS SUPERHÉROES se apuntaron al carro!!



Por último, dejaros aquí el corto original del que se inspiraron para hacer toda esta ristra de anuncios (los de la cerveza me refiero, claro está) dirigido por Chuck Stone. Un gran tipo... claro, llamándose Chuck...

TRUE.

Mis abuelos, mis padres.

Mi abuelo era de León. No tengo muy claro de qué pueblo exactamente.

Mi abuelo se casó con mi abuela (claro está), que también era de León, y tuvieron tres hijas. Mi madre es la mediana (y la mejor, que para eso es mi madre).

Como por allí no había mucho trabajo, se fueron a Bilbao. Mi abuelo, mi abuela, las dos petardas (porque eso son) y mi madre.

Mi abuelo y mi abuela se dedicaban a la costura. Mi abuelo era sastre y mi abuela también. Supongo que de ellos me viene desde pequeña el haberme querido dedicar a las telas, alfileres, agujas y patrones. Intento frustrado por mi parte.

A parte de eso, mi abuelo se dedicaba a otros trabajos durante muchas horas en los astilleros para traer más dinero a casa. Mi abuela era la jefa con las agujas de hacer punto, a parte de que cosía, llevaba la casa y se ocupaba de las niñas.

A pesar de que había que trabajar mucho, mi madre siempre recuerda las navidades y todos los días que pasó con sus padres... hasta los siete años.

Mi abuelo tenía un hermano. El típico de la familia de por entonces que se va a Estados Unidos a hacer fortuna. Y lo consiguió. Así que mi abuelo decidió ir para allá a ver qué podía conseguir para su familia.

Pero nunca llegó. Mi abuelo tenía cáncer de estómago y una de las razones por las que iba era porque allí le podrían tratar, cosa que en España por aquellos entonces no se podía.

Mi abuela y las niñas fueron a despedirle. Y supongo que mi abuelo les diría que pronto se volverían a ver.

Pero mi abuelo nunca llegó cumplir esas palabras. Cuando llegó a Florida ni siquiera llegó a pisar el suelo porque se lo llevaron directamente a un hospital donde moriría.

Mi madre se quedó huérfana con 7 años. Los siete siguientes los pasaría internada en un colegio de monjas junto con sus hermanas porque mi abuela no podía con todo ella sola. Sólo veía a sus hijas una vez al mes.

Mi madre era la que más tiempo pasaba con sus padres y era la debilidad de mi abuelo.

Yo creo que mi abuelo hubiera sido un abuelo estupendo. Creo que me hubiera encantado conocer a mi abuelo y que me habría enseñado muchas cosas... sobre todo a no tenerle miedo a las agujas. Pero sobre todo me encantaría ver a mi abuelo con mi madre, ella le recuerda como si fuera ayer. Puedo sentir lo mucho que le echa de menos.

Mi abuela murió hace 6 años de cáncer también. La he mencionado varias veces.

Mi abuela era la mejor. Mi abuela era lo más. Mi abuela me hizo jerseys, mantas, calcetines para dormir... en lana. Era la mejor cocinera del mundo, cariñosa, alegre, simpática y buena persona como pocas he conocido.

Reconozco que no lloré mucho en su funeral. Supongo que porque todavía no me lo podía creer. Cómo se iba a morir mi abuela? Jajajaja... pero qué me estás contando? Si no tenía ni 70 años todavía! Pero si tres días después iba a ser el día de reyes y tenía que llamarnos para preguntarnos qué nos habían traído!!

Y cada vez que veo a mi madre emocionarse cuando habla de la suya no puedo evitar pensar qué me pasará si algún día mis padres me faltan. Mis padres serán como les ha tocado ser, pero son mis padres y lo han dado todo por mi hermano y por mí. Soy una cascarrabias y bastante independiente pero siempre y cuando sepa que mis padres están ahí.

De mi abuelo me quedan algunas fotos antiguas, sus enormes tijeras de sastre, cuadernos con sus patrones de trajes de la época y una manta hecha con retales de tejidos gruesos de lana. Y lo que me cuenta mi madre.

De mi abuela también tengo fotos, una cajita de plata, un anillo y unos pendientes de plata y esmalte... y sus agujas de hacer punto. Y muchos recuerdos.

Eso es lo único que tengo de ellos.

Si alguna vez me faltan mis padres, no quiero quedarme con la sensación de que no retuve lo suficiente de ellos.

domingo, 16 de abril de 2006

Cuándo se pueden decir ESAS palabras?

Samantha dice que si lo que quieres es quitarte a un tío que te da la plasta lo mejor es decírselo.

Cómo que el qué?

"Te quiero"!!

Si un tío no te deja en paz y no puedes más con SU vida, dile esas dos palabras mágicas: saldrá por patas.

Parece ser que es el mejor sistema ahuyentador para esta parte de la especie humana. Más efectivo incluso que el tradicional "me duele la cabeza" (porque tienes que usarlo habitualmente y depende de la paciencia y/o nivel de abstinencia de cada uno) o "mis padres quieren conocerte" (porque total lo máximo que puede significar es una comida/cena-peñazo en el peor de los casos).

Pero si dices esas dos palabras... ve empezando a cambiar las iniciales bordadas del ajuar chata! Las llamadas empezarán a espaciarse más y más en el tiempo, las citas románticas (aunque sólo sea para estar horas decidiendo qué hacer, para luego no hacer nada) también, los sms, las tardes de agilipollamiento en el sofá de los domingos y desaparecerán los "cuelgatú, notú, notúprimero".

Ahora, si es él quien te lo dice primero... te tienes que sentir como si te hubiera tocado la lotería!! Hay que joderse! Cómo si a las tías no nos acojonara!!

En las pocas ocasiones que he tenido pareja, han sido ellos los primeros quienes me han dicho ESO y claro... yo con mi cara de póker. Porque, amoavé, me pillan por sorpresa. No, no es como cuando te hueles que te van a hacer una fiesta sorpresa de cumpleaños, donde todo el mundo chilla entusiasmado... SORPRESA!!... y tú haces tu mejor interpretación (digna de un Golden Globe, un Oscar, un Emi, un Goya, un Toni y un TP) poniendo cara de sorprendida y diciendo... "Caray, no me lo esperaba! Sois geniales!"

Aaaaaaaaaaay... qué lástima!

Sí, esos tres me dijeron "te quiero" ellos primero. ELLOS... A MÍ! Claro, claro, me sentí muy bien, feliz, contenta... pero sobre todo: flipada.

"Cómo? Que este tío me quiere? A mí? Está seguro? Oh por favor que no ponga cara de deberíahaberlodicho!... anda! pero si encima sonríe!... y yo qué hago?... Sonrío?... le digo lo mismo?... mmmm... rápido, rápido, reacciona!"

Y sonreí.

Las 3 veces.

Con el tiempo, no mucho, yo también aprendí a decir esas dos palabras malditas.

Qué bonito! Una se siente tan... rara! Porque claro, tú ves las pelis y ahí todo el mundo se quiere, repiten esa misma mini-frase constantemente... "ailofllu" por aquí... "ailofllu" por allá... y tú te sientes como más mejor, como si hubieras estado estudiando para un examen, te ha costado, pero lo has conseguido: ya tienes licencia para decir "ailofllu" cuando te salga de las narices!

Pero no os confundáis pequeñas. Todo va a a parecer fantástico... increíble... no podrás creer que
ESE tío te trate de esa manera... que tenga ojitos solamente para ti... no, no, no... despiérta cacho tonta! No ves que todo es mentira??

En cuanto tú le digas... ESO... en su cabeza algo hará clic y la cuenta atrás habrá comenzado. Algo así como: "por fin lo he conseguido, ya no hay emoción... to antoher thing butterfly"... Y será el fin.

Tú te irás emocionando cada día un poquito más y todas las inseguridades que albergabas sobre tu relación en general con el sexo masculino y en particular con tu churri, desaparecerán. Serás como Bambi correteando por el bosque florido... Como cuando Dumbo descubre que puede volar con sus orejas... Como cuando ves "Pretty woman" y te emocionas cuando Richard Gere da la vuelta de camino al aeropuerto para demostrarle su amor a Julia Roberts...

Pero a que nadie se acuerda de que el bosque de Bambi se quemó? Y de que Dumbo es un elefante y NO VUELAN?? Y de que antes de que pase toda esa gilipollez del enamoramiento, el personaje de la Roberts... es puta?

Estas dos palabras son un arma de doble filo. Nunca sabes cuál es el momento apropiado para decirlas así que si te salen espontáneamente... bien... qué le vamos a hacer... tampoco es algo que puedas planear pero... Como se suele decir: reza por lo mejor y espera lo peor.

Ni qué decir tiene que en el momento en que servidora dijo "eso" todo se fue a la porra al poco tiempo (aunq en un caso la relación siguiera... angustiosamente, pero siguiera). Por eso yo, no es que no vaya a volver a decirlo: pero no me van a pillar tan fácilmente.

Lo dicho. Que quieres deshacerte de él y te da como cosa cortar tú?... Dile "te quiero", el 90% de las veces funciona. Es casi, casi como un condón jajajaja.

pd: sé que voy a recibir muchos comments en plan "no exageres", "eso es porque has tenido malas experiencias"... a lo que yo respondo... 3 de 3? Eso no son coincidencias, son SEÑALES. Esta es mi opinión y, por supuesto, cada un@ tendrá la suya... que yo respeto. Resentida?... Sí, qué pasa? Besssssssssurrris pa tos!!


Image Hosted by ImageShack.us

Este es el resultado de la encuesta que finalizó ayer y escribiré sobre las cosas que me recuerdan determinados bloggers que aparecen de vez en cuando por aquí ;-) Ya podéis votar en la nueva encuesta hasta el próximo sábado.

Diorrrrrrrrrr, la ilusión de mi vida!!

Bueno, bueno... una de tantas, peroooooooooooo... NECESITO tener esta habitación-zapatero.

Es de MariCari. Que dice la muy petarda que tiene más de mil pares, pero que casi todos están almacenados. Mi educación y mi saber estar no me permite denominarte con una palabra que empieza por "pu" y acaba por "ta", pero la estoy pensando. Y si los pensamientos tuvieran volumen, estaría pensando esa palabra muy pero que muy alto.


No puedo con ella, no puedo con ella, no puedo con ellaaaaaaaaaaaaaaaaaa... qué mala es la envidia!! Ah y con MariCari tampoco puedo.

Se cerró la encuesta, en breve la nueva, el post sobre el tema ganador de la semana pasada y así sucesivamente hasta que me canse :-)

sábado, 15 de abril de 2006

Hasta pronto Bandel!!



Buen viaje Bandel. Te voy a echar mucho de menos.

Sigue tan guapa y requetemaja como siempre!!

Miles de besos.

Lo tengo todo preparado.

En la mesa del comedor voy a poner lo siguiente:

Y creo que con todo eso tendré suficiente.

Después de leer las últimas declaraciones de esta ggggggilipollas...

"I've always had a great voice. You either have it or you don't. It's something you're born with. I'm a brand, a model, an artiste, an actress, a designer. I write books." ("Yo siempre he tenido una gran voz. Lo tienes o no lo tienes. Naces con ello. Soy una marca, modelo, artista, actriz, diseñadora. Escribo libros")

... necesito una excusa para vomitar por esa modestia que brilla por su ausencia. Si al menos fuera verdad bonica!!

Ah! que lo sepáis...

Si esta perraca... sí, sí, la ParisJilton de los cataplines, va a tener su propia serie de dibujos animados...


Image Hosted by ImageShack.us

... incluyendo a su hermanita Nicky y Tinkerbell, el rati-perro... YO TAMBIÉN QUIERO!!

Amosfaltaríaplus! Yo no tengo animal de compañía, mi iPod da el pego si le encasqueto unas orejillas?

Ella tendrá pasta pero yo... vamos yo... mmmm... osea... mesentiende?... ea, que quiero mi propia serie de dibujos y punto pelota!

Por cierto, ya me he hecho una camiseta con el siguiente slogan: "I hate Tinkerbell"

Aún estoy pensando si por detrás le pongo: "SSG rules"

Separadas al nacer, unidas por el mismo bañador.


Pues sí, porque Cristi es asinj de espléndida.

En la foto de la izquierda podemos ver a la nueva sensación latina, Eva desesperada Longoria, presentando los premios de la Mtv del año pasado. Peeeeeeeeeeeero... en la foto de la derecha podemos comprobar que nuestra Cristi llevaba el mismo modelito hace 2 años en Roma cuando le dijeron: "eh, tú! que si quieres presentar nuestros premios europeos... te me viste de monja y luego te rasgas las vestiduras en plan guarrindongo pa poner a tono al personal"

Y Cristi dijo: "pues vale"

"Oh my god! Sólo espero que lavaran el bañador antes de dárselo a Eva!"

Ains Jenni, de verdazzz, que la gente de la Mtv maneja pasta tía, para un fregoteo les llega!! Hija, es que estás de un sensible desde que tu ex te dejó por la Jolie... Que yo lo comprendo, en serio. Pero míralo por el lado bueno: tu Vince es más alto... más moreno... más macizorro... ejem... me lo prestas??

miércoles, 12 de abril de 2006

No me gustan los rubios.

No, no me gustan.

Como dice en su
blog el señor de Martino, a las mujeres nos suelen gustar los hombres de pelo oscuro y con ojos azules. Bien, yo también formo parte de esa estadística: mi gusto por Bono, George y Robbie así lo demuestra.

Peeeeeeeeero... siempre hay una excepción que confirma la regla.

No, no es Brad estoyhastaenlasopa Pitt.



Quién es este mozo tan requetemajo que me tiene locaaaaaaaaaaaaaaaza perdida? Simon Baker. Es el prota de "The Guardian" una serie de un abogado y blablabla... mirad el Canal Cosmo cuando podáis.

Lo que me fascina es, a parte de que está tremendamente buenorro, que su primera peli en el cine fue "L.A. Confidential" en 1997... Y no recuerdo su personaje!! Cómo no me fijé??

Y, además, también saldrá en la peli basada en el libro del mismo título "El diablo viste de Prada" donde también saldrá Meryl Streep y Anne Hathaway. Es la típica historia sobre el cruel mundo de las revistas de moda y blablabla... ya lo leeréis si os interesa. El caso es que intentaré no perdérmela.

Cada tarde me pongo delante de la tv, puntual como un reloj suizo (y el puto camión de la basura a las 3:30 de la madrugada), después de ver a los Fab 5 para ver a este rubiazo macizorro... me pregunto si habrá algún episodio donde salga, al menos, sin camisa.

Claro que, a falta de rubiazo bueno es un bocata, digo yo. Porque hoy he comido de 13 a 14 y claro, llegan las 21 horas y a una le empieza a sonar hasta el alma con el hambre que me entra. Y yo hoy tenía hambre de un señor bocata de chorizo. Ya, ya lo sé, no es nada glamuroso, pero a mí me encantan los bocatas de chorizo... y los de jamón serrano ni os cuento.

Inocente de mí, cuando SuperSonicMom me ha preguntado qué quería para cenar, yo le he soltado un rotundo "bocaaaaaaaaataaaaaaaaaa".

En su lugar, ante mi presencia ha aparecido una señorita sangüis de pan de molde integral jamón, tomate y queso de untar a escala hobbit.

Ese es el concepto que tiene mi progenitora sobre un bocaaaaataaaaaaa.

El de mi hermano era media barra de pan con mortadela, queso, tomate y mayonesa.

Mi postre? Una estupenda limonada casera calentita con miel, porque llevo varios días con tos de tuberculosa.

Y mientras intentaba reponerme de mi intento frustrado de irme a la cama pensando en que nunca más cenaría tanto... voy y me encuentro con esto:

Recuerdo cuando ParisJilton se mosqueó tantísimo cuando Hugh Hefner le propuso posar desnuda para su revista, a cambio de una pastaza que ríete tú del escándalo de Marbiella y tal y tal, y ella dijo que nanai de la China.

Hugh: "Pero, pero... por qué?"

ParisJilton: "Pues porque yo soy la Paris"

Y se quedó tan ancha. Total, el chichi ya se lo hemos visto todos y hacer otras guarreridas de gratis.

Ahí la tenéis haciendo el paripé quasi-orgásmico a lo Monroe cuando gimió el japiverdei para Kennedy, pero ParisJilton, como es ella, Paris, en bragas.

Otra cosa que me ha fascinado es... que Brinni aún puede liarla más!!

Esta chica, a parte de tener un marido impresentable (no me cansaré de repetirlo), hace unas semanas se va de comilona a un restaurante mega-fashion de Hollywood. Y qué hace la muy guarra? Cambiarle el pañal a su bebé... en la mesa!!

Es que esto ya es de juzgado de guardia nenis!! Pagar un pico por un canapé consistente en 2 guisantes y una mini-zanahoria para oler la mierda del bebé de la Brinni. Hay que ser impresentable!!... No, perdón, hay que ser ella!

Pero no, esto no es de juzgado de guardia. Jajajaja esta chica puede llegar mucho más lejos aún porque resulta que el niño se cae de la trona y se pega un leñazo que no veas. Como madre primeriza (y totalmente irresponsable) que eres... no pones el grito en el cielo y te llevas al bebé al primer sitio de urgencias que encuentres?

No. Brinni no. Porque ella es así de natural (como la mierda de escultura anti-aborto con su jeta que ha realizado un oportunista que no sabía cómo ganar pasta). 6 días es lo que ha tardado la ex-princesita del pop en llevar al chavalín al médico al darse cuenta de que el crío presentaba síntomas de entumecimiento y se le notaba adormilado.

Diagnóstico: traumatismo craneal.

Con lo cual los servicios sociales, POR SEGUNDA VEZ, han tenido que visitar el bienavenido hogar de los Spearderline.

Qué hacía Brinni mientras el pequeño gordito veía cómo se acercaba el duro suelo hacia su tierna cabecita?

Por lo visto ensayando sus requete-repetidos mismos pasos de baile para una canción que le ha dedicado a su hermana pequeña. Mu bien maja! A sudar que te hace falta!

Una vez dicho esto y haber visto a la atontadas estas hasta llegar a las arcadas, me voy a vomitar la señorita sangüis.

Al menos espero tener algún sueño erótico con el macizorro del principio, en compensación por daños y perjuicios.

EEEEEEWWWWWW!!!


Después de ver esta foto no me va a dar ningún tipo de vergüenza ir a la playa con mi bikini... ni siquiera si es 4 tallas más pequeño... ni subirme las tirillas de la braguica a modo de tirantes... ni ponerme extensiones de pelo de cola de caballo... ni hacerme coletas... ni subirme a un pseudo-columpio fabricado con una cuerda y una toalla doblada a modo de asiento.

Vamos, que tampoco me daría ninguna vergüenza cambiarme el nombre y llamarme MariCari. Se ve que no va de serie...

Claro que viendo a esta triste niña rica, tampoco tendré cargo de conciencia por haberme jalado ayer 1 bola de helado de banoffee y otra de dulce de leche con un chorretón de chocolate con leche calentito, cortesía de Häagen Dazs.

Alguien tiene que comerse lo que la petarda esta de Nicole Richie se niega a degustar, no?

Escuchando: siguiendo con la tortura musical a la que me veo sometida... una triunfita que canta algo de "corassssón, corassssón de fuego". Puede alguien acabar con mi agonía y darme un golpe seco en la nuca?

martes, 11 de abril de 2006

Hoy es jueves...

... y mañana será viernes.

Y no me equivoco porque para mí hoy es como si fuera jueves. Casi, casi a las puertas de un laaaaaaargo fin de semana. El jueves (el de verdad) y el viernes (el de verdad) y el lunes (también el de verdad) voy no hay que trabajar... al menos en esta empresa jurjurjur.

Es genial! Nunca había tenido un trabajo en que tubiera todos los fines de semana libres y encima se tomaran tan en serio las fiestas nacionales. Olé!

Mientras tanto creo que hoy ha sido el día más... tostón. No es que no haya tenido cosas que hacer, que va! pero entre que ha venido la comercial de Vomistar a darme una especie de cursillo (claro, yo es que trabajaba para los 2 competidores directos y tengo argumentos más que de sobra para que nadie sea azul, pero ahora voy a tener que callarme) y he estado haciendo algunas cosas yo solita por primera vez, pues nada, que no me he aburrido.

Ahora, eso sí, vaya rollazo tener que sacar el puñetero comunicado. La madre que los parió. Más de 40 hojas entre words y excels. Viva el fin del Amazonas!! Y así cada 15 días... o cuando se les ocurra a estos de Timofónica.

Ains... se me ha olvidado enviarle un sms a una amiga esta mañana para decirle donde hay una protectora de animales. Quiere un gato. Al llegar aquí me he puesto a hacer la caja de ayer, le he escrito el sms y con las prisas le he dao a todos los botones menos al de enviar. Oooossssshhhhh!!

Me queda una hora para irme a casa. Llamaré a mi bandel a ver si quiere que vayamos a tomar algo. Otra que se me pira, pero esta vez a Málaga. Pero qué tiene la peña con irse de allá para acá?? M'estoy cansando de tener
l@s amig@s desperdiga@s por ahí!! Qué de zufrí por Dior!

A todo esto, que la Paltrow ya ha tenido su segundo hijo. Y no, no lo ha llamado kiwi, como yo pensaba, después de haber llamado Apple a su niña. El chavalín se va a llamar Moses. Más maja la Güini, que siempre se inspira en las sugerencias de su maridín (suya fue la idea del fruti-nombre), ya que está tomado del título de una canción de Coldplay.

Nada se sabe de la operación MariCampa. Al menos no he podido obtener alguna novedad, pero sigo al acecho.



De lo que sí me he enterado es de que Red Hot Chili Peppers me van a dar una tremenda alegría cuando el próximo 9 de mayo saquen su último trabajo. Estoy deseandito de escucharlo. Y es que, a parte de que Anthony Kiedis me ponga mazo, este grupo es uno de mis favoritos. No puedo esperar para echarle el guante al cd!!

Qué más, qué más... ah sí! Parece que la mierda de Marbiella y tal y tal ha salpicado hasta llegar a mi tierra. Jojojo de momento se han producido las primeras detenciones por malversación de 507.000€. Na, eso no supone más que calderilla pa nosotros los isleños de Baleares, porque claro, como aquí todo kiski supone que zemoh toh ricoh...

Casi tengo listo el post con el tema elegido en la encuesta. A ver qué os parece...

Escuchando: Gloria Estefan - Oye mi cuerpo pide salsa, cortesía del canal 40 subnormales latinos (pero que conste que esta canción me gusta)

lunes, 10 de abril de 2006

Qué fffffuerte, qué ffffffffuerte!

Aquí estaba yo pensando en cómo podría asesinar lenta y dolorosamente a un cliente atontao. Quicir, de esos que vienen de enteradillos y que quieren un móvil con "blutú" "cámara de hacé vidrio". La conversación ha sido tal que así:

Enteradillo: "Mira eh que man dicho que el (Motorola) V3 no deha pazá loh datoh por blutú y claro, m'he disho que ezo no pué ze verdá porque zinó pa qué quiereh el blutú..."

SSG: "No, no, tranmite tanto datos como voz, sinó para qué sacaría la marca los manos libres por bluetooth? Además el V3..."

Enteradillo: "... eg que a lo mehó no mesplicao bien, ozea, que no ze le pué pazá lah melodíah, que m'han costao una pasta y claro, eg que zinó no me lo compro porque..."

Imaginaos esto durante 5 minutos. El hombre que no debía de tener ni puñetera idea, que oía campanas y no sabía de dónde y encima quería corregirme... jajaja... qué fffffuerte nenis!! Que yo me puedo equivocar de muchas cosas pero vamos, firmo ande sea que la patata del Motorola V3 tiene bluetooth y además es tanto para datos como para voz.

Enteradillo: "Pero tú estáh segura? no vaya a ze que el blutú no me paze lah melodíah..."

SSG: (sonrisa profidén rallando lo maligno) "Estoy tan segura como que hoy ha salido el sol y este boli es azul (y llevar la gomilla de los calzoncillos por encima del pantalón de chándal es de lo más ordinario)"

Andevé leñes!

Pero lo que realmente es ffffffuerte, ffffffffuerte, fffffuerte es lo de la MariCampa!! La madre del topo! Que la han detenido y yo con estos pelossssss!! Me estoy imaginando a la Esteban... oig... no me pierdo las revistas de esta semana, ni el Salsa Rosa del próximo sábado y me voy a grabar todos los Tomate!!

La tía falsificando papelotes para que le den la jubilación anticipada a su opá, asín, by the face!! Qué fffffffffuerte!! Encima de que la descubren, la detienen, se entera to Dior jajaja y para rematar, su marido passsssssssa de todo, ni la va a buscar a los juzgados y en su lugar manda al chófer.

Jojojojojo me troncho yo mismamente!! Viva la Esteban y la alegría que debe gastar en estos momentos!! Me meo toa!

pd: si vuelvo a escuchar una vez más alguna canción de la petarda de la novia de... Aloooooooooonsoooooooooo, Alooooooooonsoooooooo... le arranco los ojos al primero que la tararee. Y no es una advertencia, es una amenaza en firme.

domingo, 9 de abril de 2006

SuperSonicPoll 2

Este ha sido el resultado de la encuesta:

Por aclamación popular (aplastante) escribiré un post de mi particular visión sobre la mejor forma de quitarte un tío de encima... quieras o no. Veo que el tema ha causado expectació y seguro que os intriga, pero creedme, no es para tanto aunque puede que sea una de las disertaciones más entretenidas que he hecho en mi vida jajaja.

Ya está puesta la nueva encuesta así que a votarrrrrrrrrr, votarrrrrrrrrrr, votarrrrrrrrrr sin pararrrrrrrrrrr!!

viernes, 7 de abril de 2006

Katie Holmes: "Ayuda!"

Hablando de nacimientos: de cuánto está Katie Holmes? Porque... esto es normal?? Esto está durando más que el embarazo de Raquel Mosquera. Vamos, más largo que el embarazo de un elefante!! Si no me extraña que la chica no deje de darse gabeos por todo Hollywood pidiendo ayuda. Sí, sí, que parece que está de compras, pero si nos fijamos un poco yo estoy segura de que veremos alguna señal que delata que está hasta los mondongos de semejante cienciológico-bombo!


Qué hay ahí dentro? Trillizos? Un alien? Un pequeño "miniyo" del pesao de Tom que espera dominar el mundo? El nuevo gurú de la cienciología?

Y yo que pensaba que esperar el nacimiento de Miguel era lo más expectante desde el parto de Leonor...

Soy tía, soy tía, soy tíaaaaaaaaa... o algo!

Mi prima ya ha expulsado al parásito!! Ha sido este mediodía!! Casi 4 kilos de bicharraco blandito, rosa y dormilón.

MIGUEL

Para una vez que no llevo la cámara en el bolso... Anda que vaya manera de presentarte a mi público, con cara de resacoso. Andevé, me has pillao desprevenida renacuajo, pero no te has librado de la foto en el móvil mmmuuuuahahahahahaaaaaa.

Como tía que soy, tengo el pleno derecho a malcriar a este niño!! Es genial!! Mmm hubiera sido más interesante con una niña, pero bueno... tiempo al tiempo.

jueves, 6 de abril de 2006

Adelanto de lo que puede ser una carnicería.

Esta chica:



Es Miss Ceuta. Es la nueva Miss Fea 2006. Sí, Miss Fea, ese concurso alternativo y... SINCERO ante todo, que por segundo año consecutivo propone el
Tomate.

Y yo, si hubiera tenido ganas de gastarme la pasta para votar... esta chica hubiera sido el blanco de TODOS mis votos. Todos y cada uno de ellos porque, a qué aspiramos en esta vida, eh? Osea, se supone que tenemos que elegir a una pava que esté tremenda, no? Osea, que sea guapa. Una belleza elegante y cautivadora... evidentemtente con una buena figura. Sin rallar la anorexia, claro. Una mujer que muestre las curvas latinas pero... aunque en la foto no se aprecie demasiado bien... yo prefiero pensar que cuando esta chica se paseaba por el certamen en bikini estaba en pleno proceso pre-menstrual.

Joder!! Os imaginais que la llevamos a Miss Universo? Sería como llevar a Tamara a cantar La Traviatta en la ópera de Viena.

Y ya no es porque las fotos que le hicieron a esta pobre ingenua fueran rollo "Pasión de Gavilanes"... 10 años después!!

Pero bueno, vale, de acuerdo... aceptamos barriguilla hinchada como algo aceptable en un CERTAMEN DE BELLEZA DE ÁMBITO NACIONAL... pero, en serio... Ceuta... ESO es todo lo que podéis ofrecer? Luego que no nos extrañe que se regalan títulos a cambio de...

Me callo, que para mí Miss España es como Eurovisión para mi amigo Miguel: algo muy serio.

He dicho.

Escuchando: Nancys Rubias - Maquillaje

Yastamosotravez!!

4º día en mi nuevo trabajo y esto está bastante bien.

Digo bastante solamente porque claro, aún estoy aprendiendo y veo a mis compis un poco apuradas. Han cambiado el programa de facturación y van un poco de culo. Con lo cual, al ser nueva, estar aprendiendo y que cuando me enseñan algo van cambiando sobre la marcha... Me siento un poco inútil, pero ni punto de comparación con el sitio donde tenía que estar en constante contacto con ELLA, la GG (os lo recuerdo, la Gran Guarra).

Pero hay algo que no puedo soportar de este sitio. Es lo que peor llevo... madrugar?... mmmm... posiblemente, pero nada que los antihistamínicos primaverales tomados en horario nocturno no arreglen. Caigo irremediablemente en coma a los 30 minutos y duermo del tirón hasta las 7 de la mañana.

Pero no, lo que peor llevo es... la música. Sí! Otra vez!!

En la tienda hay una televisión con un tdt, con lo cual se supone que puedes ver alguna cosilla mientras vas y vienes pero... es que aquí tienen puesto el canal 40... LATINO!! Estoy hasta la mismísima coronilla de la petarrrrrrrrrrda de la novia de Alooooooooonsoooooo cantando eso de "esta soy yooooo"... perra, a ver si te casas y te dedicas a ser ama de casa coño! O la misma canción de Thalía... o peor!! Monográfico sobre el Canto del loco o el nuevo vídeo de esa triunfita que dicen que está tan buena y canta algo que dice "no quiero que te asustes" o algo así.

Es como los bares en verano: parece que tienen un puto cd y se lo van pasando unos a otros!!

Pero no sé si prefiero esto o que pongan el hilo musical. Kicir, pueden sintonizar alguna emisora o poner mp3 desde algún pc pero... ES QUE ESTO ES EL PUTO CLUB DE FANS DE ANASTACIA????

Joder, tengo que quedarme con la cara de esa chica que le gusta escuchar la Máxima FM para que la ponga más amenudo y no se sienta marginada.

Como empiece a traer cedeses míos se van a cagar patas abajo!

miércoles, 5 de abril de 2006

Arf, arf, arf!!


No puedorrrr, no puedorrrr...




Ajandermorenaorrr... pecadorrrr de la pradera, diodenarrrrrr!!



Soy asesuarrrrr, soy asssesssuarrrrrrrrrrrrr!!

Qué difícil me lo pones chato!! Con tus tattoos, tu cara de tevasanterardeloquevaleunpeine... Qué calores! Qué sudores!! Ven pacá moreno que no te va doleeeeeeeeeeeé!!

Pa qué me enseñas estas cosas Marsonico?? Con lo sensible que soy/estoy!! Ejjjj queeeeeee...

Escuchando: Alicia Keys - If I was your woman

martes, 4 de abril de 2006

Póntelo, pónselo pero sobre todo... úsalo!

Trust condoms: madre mía!! me pregunto si es una marca especializada en hombres de color... negro mayormente. A ver si va a ser cierto ese mito de que están tan bien dotados!!



Anuncio de producción sueca que promulga eso de cuando la necesidad aprieta...



Zazoo condoms: a que os suena de algo este anuncio a alguno que se ha visto recientemente en nuestra publicidad? Cuánta razón tiene este anuncio!!



Manix condoms: lo que yo os diga, los negros la tienen más grande!! Mmmm... ya, ya sé eso de que lo importante no es cantidad sino calidad pero... a mí los de color (mayormente negro jajaja) me dan morbo.



Durex: una de las marcas más tradicionales nos deleita con un anuncio muy original. A mí personalmente me da un miedo terrible... todos esos bichejos corriendo como posesos o poseídos... rollo amenazador... brrrrffffff.



Durex ulta mega thin: busco voluntario para que me deje hacer una réplica de este experimento.



Humo fruit flavored condoms: jajajaja simplemente es que me parto!! Qué bueno!! En boca cerrada no entran moscas!



Hansaplast condoms: las nuevas generaciones no son tan idiotas como yo me pensaba.


Espero no haber decepcionado a mi audiencia con estos anuncios de condones. Me encanta la publicidad y la que está bien hecha, mucho más.

Por mi parte sólo añadir que: chicos, hay suficientes variedades como para que digáis que "no es lo mismo con" y encima... son fáciles de poner! Qué más queréis??

Escuchando: Kanye West - Touch the sky
pd: no olvidéis votar por vuestro tema favorito en la nueva encuesta. Tenéis hasta el sábado.