miércoles, 12 de abril de 2006

No me gustan los rubios.

No, no me gustan.

Como dice en su
blog el señor de Martino, a las mujeres nos suelen gustar los hombres de pelo oscuro y con ojos azules. Bien, yo también formo parte de esa estadística: mi gusto por Bono, George y Robbie así lo demuestra.

Peeeeeeeeero... siempre hay una excepción que confirma la regla.

No, no es Brad estoyhastaenlasopa Pitt.



Quién es este mozo tan requetemajo que me tiene locaaaaaaaaaaaaaaaza perdida? Simon Baker. Es el prota de "The Guardian" una serie de un abogado y blablabla... mirad el Canal Cosmo cuando podáis.

Lo que me fascina es, a parte de que está tremendamente buenorro, que su primera peli en el cine fue "L.A. Confidential" en 1997... Y no recuerdo su personaje!! Cómo no me fijé??

Y, además, también saldrá en la peli basada en el libro del mismo título "El diablo viste de Prada" donde también saldrá Meryl Streep y Anne Hathaway. Es la típica historia sobre el cruel mundo de las revistas de moda y blablabla... ya lo leeréis si os interesa. El caso es que intentaré no perdérmela.

Cada tarde me pongo delante de la tv, puntual como un reloj suizo (y el puto camión de la basura a las 3:30 de la madrugada), después de ver a los Fab 5 para ver a este rubiazo macizorro... me pregunto si habrá algún episodio donde salga, al menos, sin camisa.

Claro que, a falta de rubiazo bueno es un bocata, digo yo. Porque hoy he comido de 13 a 14 y claro, llegan las 21 horas y a una le empieza a sonar hasta el alma con el hambre que me entra. Y yo hoy tenía hambre de un señor bocata de chorizo. Ya, ya lo sé, no es nada glamuroso, pero a mí me encantan los bocatas de chorizo... y los de jamón serrano ni os cuento.

Inocente de mí, cuando SuperSonicMom me ha preguntado qué quería para cenar, yo le he soltado un rotundo "bocaaaaaaaaataaaaaaaaaa".

En su lugar, ante mi presencia ha aparecido una señorita sangüis de pan de molde integral jamón, tomate y queso de untar a escala hobbit.

Ese es el concepto que tiene mi progenitora sobre un bocaaaaataaaaaaa.

El de mi hermano era media barra de pan con mortadela, queso, tomate y mayonesa.

Mi postre? Una estupenda limonada casera calentita con miel, porque llevo varios días con tos de tuberculosa.

Y mientras intentaba reponerme de mi intento frustrado de irme a la cama pensando en que nunca más cenaría tanto... voy y me encuentro con esto:

Recuerdo cuando ParisJilton se mosqueó tantísimo cuando Hugh Hefner le propuso posar desnuda para su revista, a cambio de una pastaza que ríete tú del escándalo de Marbiella y tal y tal, y ella dijo que nanai de la China.

Hugh: "Pero, pero... por qué?"

ParisJilton: "Pues porque yo soy la Paris"

Y se quedó tan ancha. Total, el chichi ya se lo hemos visto todos y hacer otras guarreridas de gratis.

Ahí la tenéis haciendo el paripé quasi-orgásmico a lo Monroe cuando gimió el japiverdei para Kennedy, pero ParisJilton, como es ella, Paris, en bragas.

Otra cosa que me ha fascinado es... que Brinni aún puede liarla más!!

Esta chica, a parte de tener un marido impresentable (no me cansaré de repetirlo), hace unas semanas se va de comilona a un restaurante mega-fashion de Hollywood. Y qué hace la muy guarra? Cambiarle el pañal a su bebé... en la mesa!!

Es que esto ya es de juzgado de guardia nenis!! Pagar un pico por un canapé consistente en 2 guisantes y una mini-zanahoria para oler la mierda del bebé de la Brinni. Hay que ser impresentable!!... No, perdón, hay que ser ella!

Pero no, esto no es de juzgado de guardia. Jajajaja esta chica puede llegar mucho más lejos aún porque resulta que el niño se cae de la trona y se pega un leñazo que no veas. Como madre primeriza (y totalmente irresponsable) que eres... no pones el grito en el cielo y te llevas al bebé al primer sitio de urgencias que encuentres?

No. Brinni no. Porque ella es así de natural (como la mierda de escultura anti-aborto con su jeta que ha realizado un oportunista que no sabía cómo ganar pasta). 6 días es lo que ha tardado la ex-princesita del pop en llevar al chavalín al médico al darse cuenta de que el crío presentaba síntomas de entumecimiento y se le notaba adormilado.

Diagnóstico: traumatismo craneal.

Con lo cual los servicios sociales, POR SEGUNDA VEZ, han tenido que visitar el bienavenido hogar de los Spearderline.

Qué hacía Brinni mientras el pequeño gordito veía cómo se acercaba el duro suelo hacia su tierna cabecita?

Por lo visto ensayando sus requete-repetidos mismos pasos de baile para una canción que le ha dedicado a su hermana pequeña. Mu bien maja! A sudar que te hace falta!

Una vez dicho esto y haber visto a la atontadas estas hasta llegar a las arcadas, me voy a vomitar la señorita sangüis.

Al menos espero tener algún sueño erótico con el macizorro del principio, en compensación por daños y perjuicios.

1 comentario:

Folken dijo...

no le quitarán el hijo porque es ella, pero a cualquier otro ya se lo estarían pensando...
Aunque peor sería ser hijo de Hilton