miércoles, 29 de junio de 2005

Frase del dia:

“Es mejor parecer idiota que abrir la boca y disipar toda duda”

Esto lo dijo ese gran sabio que fue Mark Twain que seguro que tenía un compañero nuevo (y gilipollas) en su oficina y sintió ganas de arrancarle las amígdalas con sus propias manos.

Esto ha sido, ha sido, ha sido, ha sido to-to-to-todo amigos… por hoy.

Soy gay.

Si existiera aún el programa de Rafaella Carrá y me preguntara (una de mis divas, admiro su capacidad para mejorar su italiano a pesar de haber vivido años en España): (con acento italiano que sinó no tiene gracia) “Si fueras hombre…” Yo le respondería gustosa: “Gay, Rafa, sería un auténtico palomo cojo”

Lo sé, es que lo sé, lo siento así. Dentro de mí hay un gay que a veces no puede reprimirse y que a veces, cuando habla por mi boca, se confunde con una marujona con mala leche pero, no nos engañemos: sé perfectamente que si existe la reencarnación y me toca ser tío, seré una marilocaza sin remedio. Me encanta Madonna, Gloria GAYnor y los Village People, las lentejuelas, las plumas, el maquillaje a lo dracqueen, me encanta el barrio de Chueca, vamos, SúperGay al ataque!! … y me encantaría tener un novio como Jesús Vázquez. Bueno, esto último no es muy gay porque cualquier tía hetero querría tener un maromo como este, pero da igual.

Sería un gay a los que se “les nota”, pero con estilo oyes, que para hortera ya están los Pacos: el Clavel y el Porras.

Porque a mí me gusta más un hombre que la tortilla de patatas con cebolla, más que incrustarme en el sofá para ver una peli con 1 litro de helado y más que a un tonto un lápiz. El problema va a ser que yo a los hombres no les gusto tanto, pero eso es un detalle sin importancia… o no?

The question es que para mi próxima vida si me reencarno en un hombre y soy gay tendré los mismo derechos que un hombre heterosexual y eso es reconfortante. No habrá nadie que pueda negarme mis derechos constitucionales… y a todo el mundo le parecerá normal que en mi boda con mi chulazo haya dos “Ken” en la tarta jijiji.

Viva el día del Orgullo Gay y ojalá llegue el día en que no tengamos que celebrar algo así simplemente será algo... tan normal... como la vida misma.

Ahora, si tengo que elegir, prefiero reencarnarme en una mujer… más que nada porque ya le tengo yo pillado el tranquillo.

martes, 28 de junio de 2005

Frase, comentario, reflexión y conclusión del día.

La frase:


"Mujer inteligente, soltera en potencia"


Comentario y reflexión:


No me lo he inventado yo lo dicen aquí. Mayormente esto viene a decir que cuanto más inteligente es la mujer, reduce en un 40% las posibilidades de casarse, inversamente proporcional a lo que sucede si trata de un varón.


Quicir, que una mujer busca un hombre inteligente, porque es consciente de que la gravedad también hace mella no sólo en las tetas sino también en otras partes muy masculinas y como se suele decir: siempre quedará la conversación. Y sin embargo, un hombre busca a una mujer que sea como su mamaíta, que le quiera, le mime y le cuide incondicionalmente. Una mujer tipo "mimamámemima".


Es flipante, así no me extraña que Paris Hilton se vaya a casar, si no lo ha hecho ya, que no lo sé. La cuestión es saber si su futuro marido, que también se llama Paris, es más inteligente que ella... cosa que no creo que sea muy difícil, por otro lado.


Sólo me queda decir que tengo que ser, al menos, un 40% más inteligente que muchos tíos... porque aún sigo soltera, solterisisisíiiiima. Es más, creo que muchas de nosotras debemos ser un 40% más inteligentes que muchos tíos porque es increíble la cantidad de solteras que hay. Claro que también me pongo a pensar y si de toda la población femenina que está soltera, también hay lesbianas... y de momento no se pueden casar (aunque queda poco, por fin) ya no quedan tantas.


De todas formas, cada año hay más bodas, pero seguimos siendo muchas las que integramos el CSE (Club de las Solteras Empedernidas). Me pregunto si George Clooney pertenecerá a un parecido... y si es así... le interesaría a su club relacionarse con el mío? Es un poner...


Pero creo yo que entre esas chicas solteras no debo de tener yo muchas amigas, porque casi todas están casadas, ennoviadas o arrejuntadas. Vamos, que casi todas mis amigas tienen churri.


Quiere decir eso que mis amigas son menos inteligentes?... Mmmmm me da miedo seguir con esta disertación.


Conclusión:


Vaya mierda de estudio... no?

lunes, 27 de junio de 2005

Parecía misión imposible...

... pero sí, realmente todavía se puede sobrepasar los límites de mi estupefacción e incredulidad leyendo estas cosas estando ya en el anhelado siglo XXI. Y que conste que ya me parecían increíbles en el siglo pasado.

No digo más.

Es lunes, horrible lunes.


Necesito mi ración diaria de 2-3 galletas Granola con chocolate o HobNobs.

Al menos ya son oficiales las fechas de mis vacas para agosto. Y sólo puedo decir que justamente soy la única a la que el 15 se le añade como día de vacas extra ;-) Que te jodan "nuevo" de la oficina, por bocas coño. Que has llegado el último y quieres tenerlo todo!

Vaya, parece que el lunes no es tan horrible como son todos los lunes :-D

Escuchando: U2 - City of blinding lights (cómo me flipa esta canción!!)

sábado, 25 de junio de 2005

Simples pero me hacen reír :-D


- Cómo se llama un tomate con capa? -----> Súper Tomate

- Y un limón con capa? ----> Un Súper Limón... ERROOOOOOOOOOOOOOR!! Es un limón disfrazado de Súper Tomate!!

Otro, otro jajajaja:

- Cómo se llama un boomerang que lo tiras y no vuelve? ----> PALO!!

Jajajajajajaja... cada vez que me cuentan estos chistes me parto de la risa.

Qué le voy a hacer... si es que me río con ná!!!

jueves, 23 de junio de 2005

Aquilino y sus amiguitos peperos.

Bueno, bueno, buenooooooo. Que hoy vengo locaaaaaaaaaa (como la Malena Gracia, esa pseudo lesbi-chic modenna) por hacer mi comentario en el blog. Si es que me lo han puesto a huevo y no puedo resistir la tentanción. No puedorrrrr, no puedorrrrrrrrrrr…

Y todo a raíz que a unos cuantos retrasados mentales (lo digo porque sus mentes se quedaron en los retrasados tiempos de la Edad Media) se les ocurrió hacer un partidete fascista y retrógrado llamado PP. Que tendrá sus cosas buenas, seguro, pero por el momento toda su credibilidad cae por tierra cuando presentan a semejante personajillo para que respalde su teoría de porqué no debe aprobarse la ley de matrimonios y adopción por parte de gays.

Aquilino, Aquilino, majete, que está usted muy mayor para decir tantas gilipolleces. Que por muy catedrático que sea a ver si se lava usted más la boquita. Para empezar: qué coño es eso de personas humanas? Si ya creo que lo dije una vez, es que también existen las personas ornitorrinco o los humanos gotelé? Mireusté, me lo va explicando porque sigo sin entenderlo.

Y ya, lo que me fascina, que tiene estupefacta y a-lu-ci-na-da es cuando dice: “y es que a estas alturas pasan de los 160 los hombres y mujeres de conducta homosexual que han solicitado mi ayuda humanitaria como terapeuta” Ayuda humanitaria caris, AYUDA HUMANITARIA!! Ayuda humanitaria es lo que hacen Médicos
Sin Fronteras o Cruz Roja cuando ocurre alguna catástrofe y salen echando leches para arrimar el hombro. Es cuando estás bajo mínimos de ánimo y llega un amigo y te hace sonreír. Es cuando eres tan buena persona que apadrinas a un niño de donde sea para que pueda ir al colegio y tener un futuro más digno.

Lo que usted ha hecho no es nada que pueda calificarse de humanitario, si acaso, de monstruoso. Cómo se atreve a decir a esas más de 160 personas que su elección sexual es una patología y que son “defectuosos”? No tiene ningún tipo de remordimiento en su conciencia? Es más, tiene usted conciencia? Miedo me daría tener que asistir a sus clases. Qué digo miedo… vergüenza, terror y verdadera fobia de tener que pasar por el aro de sus retorcidos pensamientos para poder obtener un título. Usted es como su perrito: "Aquilinín, ataca, ataca".

Para que vea con qué clase de gente se junta, ahora sus
amiguitos peperos se desdicen de sus palabras y reniegan de usted. Pero no señores y señoras peperistas, les recuerdo que este “experto” era su principal representante, así que no escurran al bulto ahora. Aunque bien mirado, es lo que suelen hacer ustedes cuando las cosas no les salen bien, verdad?.

Como revancha han rechazado la aprobación de la ley a favor de los matrimonios gays y la adopción de niños por parte de estos “defectuosos”. Su otro principal argumentos es decir que ya hay una ley reguladora para las parejas de hecho y existen los matrimonios civiles. Creo que tampoco hace falta que recordemos al mundo que ustedes se negaron también a dar su apoyo a la ley de divorcio, matrimonios civiles, parejas de hecho y aborto.

Por cierto, qué opinan del divorcio de Álvarez-Cascos?


Con esto vienen a decir que para qué van a aprobar la boda de dos “enfermos mentales” (yo es que tengo el DSM-IV porque estudio psicología y no encuentro nada de un trastorno llamado homosexualidad) que va a ser mucha molestia lo de reformar la Constitución. Tócate los pies! Pues se reforma, leches, se reforma.

Vaya excusa trapera!! Como dice Diego Serrano, lo que pasa es que ustedes tienen la mirada sucia! Sucia, sucia, suciaaaaa! Déjense de fascismos e intolerancias y pemitan que la gente sea feliz siendo hetero o gay. Cuántos de entre ustedes y la iglesia habrá de “defectuosos” y no dicen nada.
Tiempo al tiempo, esa ley será una realidad dentro de poco y ustedes tendrán que callarse la boquita y ponerse gafas para ver mejor el panorma actual.

miércoles, 22 de junio de 2005

EL TEST DE ER MANUÉ

Estaba deseosa de poder comenzar una cadena chunga de esas que te mandan por mail, me pasé por el blog de Er Manué, le pedí permiso para tomar prestadas estas preguntillas y como me dijo que sí... allá que voooooyyyyyyyy!!
  1. Nombre: Mara Jade (si te lo crees, te lo crees y sinó… ahí te quedas)
  2. Te pusieron el nombre por alguien?: Sí. Es una pequeña historia. Mi madre me quería poner Leticia (os imaginais qué horror hubiera sufrido1º con la Sabater y ahora con la princesisisisisima?) Y mi abuela decidió que una nieta suya no se iba a llamar Tiricia (no entendió bien el nombre) y como era ella quien me iba a inscribir en el registro (porque mi papá estaba de viaje) me puso el nombre que le dio la real gana, que es…
  3. Pides deseos a las estrellas?: Mmm las estrellas del techo del Pachá o de mi cuarto cuentan?
  4. Cuando fue la ultima vez que lloraste?: Hace unas semanas…
  5. Te gusta tu letra?: Cuando no me duele la muñeca por la tendinitis, po zi Amparo.
  6. Cual es tu comida favorita?: Italiana, definitivamente.
  7. Malos hábitos?: tomar demasiada azúcar o demasiada sal por temporadas, no poder "desconectar" la mente y revolcarme en mi autocompasión cuando estoy de bajón
  8. Cual es el CD mas vergonzoso que tienes?: Que no se entere nadie, no sólo el primero, sino también el 2º cd de Jennifer López.
  9. Si fueras otra persona, serias tu amigo?: Sí, seguramente me daría cuenta de que es verdad lo que dicen mis amigas, que soy una buena persona y que merezco la pena jejeje.
  10. Te gustan las emociones fuertes?: si por emociones fuertes nos referimos a hacer puenting, correr un poquitlillo cuando vas sola en el coche por la autopista de noche… sí, como dice Er Manue: porsu.
  11. Importa el físico?: No seamos hipocritillas: es en lo 1º que nos fijamos… aunque luego nos dediquemos a investigar las profundidades (y que cada uno investigue las profundidades que más le gusten)
  12. Alguna vez has dicho algo que sonó completamente estúpido?: Sí, dije “te quiero” a quien no debía.
  13. Los peces tienen sentimientos?: Si tienen memoria, por qué no van a tener sentimientos?... o no?
  14. Te gusta estar a la moda: sí, a la mía.
  15. Como desquitas tu coraje: discutiendo, siendo borde, más sarcástica, más ácida y retorcida… o simplemente me doy una vuelta en mi coche y tan contenta.
  16. Donde están tus segundos hogares: Donde estuviera mi abuela Tere, pero como ya no vive, mi segundo hogar es mi coche.
  17. Confías en otros fácilmente: NO, NO Y MIL VECES NO!
  18. Cual era tu juguete favorito cuando eras niñ@: El Cinexin y las piezas de Lego.
  19. Qué clase en la escuela piensas que no sirve para nada: La de religión y la de educación física (se nota mucho que se me daba malamente?)
  20. Tienes un diario: tengo 2, uno que dejo por aquí y el otro me lo guardo pa mí.
  21. Utilizas mucho el sarcasmo: Si no fuera sarcástica todo el mundo preguntaría dónde me he escondido y quién es esa persona.
  22. Que buscas en un/a chico/a: paciencia, sentido del humor, con 2 dedos de frente, que me adore y no sólo me quiera como amiga.
  23. Cuáles son tus apodos: en mi otro trabajo alguien me llamaba “pecepezke” pero vamos, no tengo nada más interesante.
  24. Piensas que eres fuerte: en qué sentido? Físicamente soy muy floja…
  25. Cual es tu sabor favorito de helado: vainilla, dulce de leche, yogur… y pistacho del Filippo.
  26. Cual es tu color favorito: negro, morado, azul y verde militronco.
  27. Cual es la comida que mas odias: pescado, vísceras y las 3 “a" (alcaparras, anchoas y alcachofas)
  28. Cuantas muelas del juicio tienes: 1
  29. Estas enamorado/a de alguien: Si y preferiría no estarlo.
  30. A cuantas personas le gustas: Como amiga seguro que a un montón!!
  31. Que color de pantalones llevas puestos: blanco (no me los volveré a poner, parezco la hermana de Flubber)
  32. Que estas escuchando ahora: por fin el hilo musical se ha dignado a poner una canción de U2, “Where the streets have no name”
  33. Cuales son los últimos 4 dígitos de tu numero de teléfono: antes prefiero decir el nº de pie que calzo.
  34. Que fue lo último que comiste: unas cerezas en el postre.
  35. Como esta el clima ahora: un calor que te cagas fuera y un fantástico aire acondicionado en la oficina.
  36. Quien fue la ultima persona con la que hablaste por teléfono: mi amiga y ex compi de trabajo Vero.
  37. En qué te fijas en el sexo opuesto: las manos
  38. Como estas el día de hoy: Un poco aburrida...
  39. Bebida favorita: Coca-Cola
  40. Bebida alcohólica favorita: Ron (pero tampoco bebo mucho)
  41. Deporte favorito: para ver Fórmula 1 y fútbol, para practicar natación y yoga.
  42. Color de pelo: castaño
  43. Color de ojos: castaño
  44. Usas lentes de contacto: No
  45. Hermanos/as y sus edades: 1 hermano de 24 tacos
  46. Mes favorito: en los que haga calor
  47. Ultima película que viste: En el cine, el Episodio III. En dvd, la 6ª y última temporada de “Sex & The City”
  48. Eres demasiado penoso como para invitar a alguien a salir: sí, si esa persona me gusta porque me da mucha vergüenza. Sinó, viva la juerga y la madre que me parió!
  49. Películas de terror o finales felices: Me gustan las 2 cosas.
  50. Verano o Invierno: verano, verano, veranooooooo
  51. Abrazos o besos: si es alguien a quien quiero, las 2 cosas.
  52. Una relación seria o solo rollos: ahora no sé qué quiero, lo dejo en pause.
  53. Con quién vives?: con la familia Monster
  54. Que libro estas leyendo: “El guardián entre el centeno” de Salinger.
  55. Que viste en television anoche: CSI Las Vegas (el de Miami me parece una burda imitación)
  56. Olores favoritos: Vainilla, canela y coco
  57. Que es lo primero que piensas cuando te despiertas?: Jo, no tengo ganas de levantarme.

Y ahora, el que quiera que siga la cadena... o que ésta muera aquí para siempre snif snif snif.

Por qué, por qué, por quéeeeeeeeeeeee....

Y lo más importante… Por qué lo llaman “abrefácil” cuando no hay dios bendito que lo abra como no sea a mordiscos?? EH? EH?

martes, 21 de junio de 2005

Que sí, que sí, que mi familia sale en la tv!!

Y tanto que lo es:

Mi padre tiene la misma pinta de cabreado que el tío Santiago de “Los Serrano”, aunque es un papi de puta madre y se puede hablar con él de cualquier cosa. Sólo que su careto a veces echa p’atrás.

Mi madre… ufff… como la Sole de “7 vidas”. La misma mala leche y con el mismo estilo de ropa y corte de pelo. Para mí mi mamá es la mejor, súper atenta y detallista pero… a veces en vez de madre parece que tengo un grano en el culo macho!

Mi hermano, el mejor, se parece a Shagui, el amigo de “Scooby Doo”. La misma pinta desgarbada, delgaducho, con su perilla, sus pelos y cara de empanao. Es un chaval súper tímido, pero cuando coge confianza… No hay dios que lo calle!!

Mi abuela Tere, que en paz descanse la pobre, era un híbrido entre Lina Morgan y el Correcaminos. Tenía las mismas salidas cómicas y las mismas piernas que la Reme (el personaje de la Morgan) y mi abuela no andaba, hacía los 100 metros lisos cuando iba por la calle. Cada dos por tres tenía que decirle: “abuelaaaaaaaaaaa… tienes prisa?”

Mi madrina Susi, como Roseanne. Sólo que ella es rubia y tiene mejores modales, pero el vozarrón y la apariencia, la misma: bajita y regordeta. Y mi padrino Dieter, alto, rubio y con ojos azules, el típico alemán, claro. Me recuerda un poco a Fénix, el del “Equipo A”. A mi no me parecía guapo el tío este en cuestión, pero digamos que era el más bien parecido jijiji. El “guapo despistao”, pues ese es mi padrino.

Falto yo… es que no tengo mucha familia, todo hay que decirlo. Yo soy de pequeña era la Yoli, la amiga gordi con gafas y feucha de Teté, otra de “Los Serrano”. Ahora?... pos no lo sé, a lo mejor mi apariencia puede haber cambiado, uso unas gafas más fashion (de pija empollona como digo), soy más irónica, sarcástica y aunque he aprendido a valorarme muchísimo más que antaño, en mi interior me sigo a veces sintiendo como la amiga gordi y feucha de mis amigas jejeje. Aunque eso sí, amiga de verdad y pocos me ganan siendo la alegría de la huerta!! Porque yo lo valgo!

lunes, 20 de junio de 2005

Se escribe con "g", con "g" de gilipollas.


Por fin!! Es que unos me decían que con “j” otros con “g”… a mí me sonaba más con “g” pero bueno, a veces hay explicaciones que resultan tan conviencentes.

Aquí podéis comprobar que realmente se escribe con “g” y no con “j” y su significado.

Una vez realizadas estas comprobaciones ya me siento más tranquila para poder decir:

  • EQUIPO FERRARI, GILIPOLLAS!
  • CONFERENCIA EPISCOPAL Y SIMPATIZANTES, GILIPOLLAS!!
  • FRAGA-GÁ, GILIPOLLAS!!
  • “NUEVO” DE MI OFICINA, GILIPOLLAS!!
  • ETOÓ, GILIPOLLAS!!

De pequeña, en el cole, nos decían que cuando decimos una palabra nueva 3 veces ya pertenecía a nuestro vocabulario. Teniendo en cuenta que para mí esta palabra era "técnicamente" nueva al averiguar por fin cómo se escribía corectamente, creo que no es que ya pertenezca a mi vocabulario: la he dicho tantas veces que está en el ranking de mis 10 palabras favoritas :-D

domingo, 19 de junio de 2005

GRAVE


El viernes escribí un post sobre la publicidad con tintes machistas (anuncios de hornos, detergentes y demás parafernalia que se supone femenina) y otros anuncios ho-rro-ro-sa-men-te estúpidos (Cruzcampo, Dermovagisil, Nivea Men, entre otros) que hay en la tv. Me fijo porque me gusta mirar anuncios nuevos. Qué le voy a hacer si soy así de rara?.

Pero lo he borrado, porque recibí un post de mi amigo Wachowsky opinando que era patético, una excusa para criticar al género masculino y lo peor que había escrito en mucho tiempo. Desde luego no se puede decir que sea un inssssssssincero (como diría ese gran gurú veraniego que es Pocholo). Y es algo de agradecer, al menos por mi parte.

Bueno, tal vez sea cierto o tal vez no.

Lo importante es que NO me ha gustado leer la palabra "patético" sobre algo que opino y por eso lo he quitado... y porque no quiero entrar en polémicas. No, porque ya soy un año más mayor y más cascarrabias, no tengo ganas de discutir y porque realmente no pienso que todos los hombres del universo sean unos cerdos machistas y cortos de mente que no sepan hacer un anuncio (como por ejemplo: Budweiser, el nuevo Polo, el Mazda 3, Mercedes clase B o ese del síndrome de Stendhal, Heineken, Vodafone, Viajes Iberia)

Pero la cruda realidad es que en la tv vemos anuncios con prototipos femeninos que parece que por mucho que avancemos nunca cambian o anuncios en los que parece que nos toman por tont@s. Y sí, muchas de esas campañas están ideadas por hombres. Pero de ahí a pensar que ODIO sistemáticamente a los hombres... en momentos de mi más extremo cabreo, SÍ, pero si fuera cierto habría escrito directamente "odio a los hombres" en vez de irme por las ramas. Que yo tampoco soy una inssssssincera y creo que lo he demostrado con creces.

He quitado un post... pero eso no es lo verdaderamente grave. Lo verdaderamente grave sería si no fuera capaz de "reconstruir" mis ideas y no ser tan brusca a la hora de explicarlas, no?

Pues a eso me dedicaré. A enmendar mis errores :-D

Vaya pérdida de tiempo.

Para eso me vengo yo corriendo desde la playa jugándome la vida en la autovía?? Para eso me vengo con los pieses llenos de arena, he puesto perdido el coche con el susodicho elemento para no llegar tarde y con el bikini mojado?

PARA VER ESA MIERDA DE CARRERA DE FÓRMULA 1?? PARA VER ESA PANTOMIMA LAMENTABLE??

Al menos Raikkonen tampoco ha corrido... y el que no se consuela es porque no quiere, hala!

viernes, 17 de junio de 2005

Lindezas de un troglodita llamado Fraga-gá

“Las encuestas no son fiables, por ejemplo una mujer nunca diría la verdad sobre con cuantos hombres se acuesta”

“Gobierno paritario no, pero pondré todas las facilidades para que las mujeres puedan cumplir con su principal misión: tener hijos”

“Los matrimonios gay son una asquerosidad”

En serio hay gente que votará a semejante vejestorio retrógrado machista, colaborador de Franco y que se dedicó a seguir cazando mientras las costas de su adorada Galicia se llenaran de petróleo?

Sinceramente, espero que en las elecciones salgas con una buena patada en tu culo arrugado.

jueves, 16 de junio de 2005

Crimen de honor.

Estoy tan indignada que ni siquiera me sale algo tan natural como llorar. Ni siquiera eso, ni siquiera imaginando que me hubiera podido pasar a mí si no hubiera tenido tanta suerte de nacer en un país como España… Ni siquiera así me puedo imaginar lo que Mukhataran Bibi ha debido pasar.

Crimen de honor? Condenada a ser violada por un crimen de honor? QUE ENCIMA ELLA NO HABÍA COMETIDO, SINO EL PATÁN DE SU HERMANO?

Y encima resulta que el presidente de su país, Pakistán (sí, sí, del mismo sitio que el loco de la colina que me mira cada vez que entra a la oficina) decidió ayudarla. Claro, ayudarla condenando a los que la habían violado y dándole dinero para mantenerla… pero no le ha hecho tanta gracia que la pobre mujer alzara la voz para denunciar LAS SALVAJADAS que se cometen contra las mujeres en estos países de trastornados de testosterona, prepotencia y soberbia. Al señor presidente de este país, cuyo nombre de dicho personajillo no pienso ni mencionar del asssssssco tremendo que me da, ha ordenado que se la tenga retenida en su domicilio y sin teléfono para no poder ponerse en contacto con nadie. No deja que viaje a EEUU donde varias organizaciones humanitarias quieren que se conozca su historia.

Pero, CÓMO SE ATREVEN? Cómo se creen con el derecho de tomar la decisión de violar a una mujer, así por la cara, públicamente y encima pretender quedar impunes??? ALGUIEN SIENTE TANTA INCREDULIDAD COMO YO?? DÓNDE PONE ESO EN EL CORÁN?? DÓNDE? Estos son los países que dejamos que colaboren para encontrar a Bin Laden? DÓNDE ESTÁ EL EJÉRCITO DE BUSH EN ESTOS CASOS?

A estas alturas de la historia todavía tenemos que morirnos de la vergüenza por permitir que ocurran estas cosas: violencia e injusticia de género dirigidas hacia las mujeres. Por una vez, por UNA sola vez, me gustaría que los hombres que practican estas costumbres, supieran lo que se siente siendo mujer en una situación así.

miércoles, 15 de junio de 2005

Y colorín colorado... mi serie favorita se ha acabado.


Ya está? Eso es todo?

Acabo de ver el último episodio de la y última temporada de “Sexo en Nueva York” Al menos podrían haber hecho una temporada más, hubiera quedado mejor: 7 temporadas. El número mágico.

Ahora qué voy a hacer? Por Carrie rescaté mis viejas manoplas, me inventé nuevas excusas para comprar zapatos, combinar ropajes de hace años con ropa nueva y me pregunté miles y miles de millones de veces: cuánto le pagarían a esta chica por escribir una columna semanal en un periódico para poder costearse ese ritmo de vida??. Qué va a ser de mí? “Mujeres desesperadas” es mi “otra” serie, pero no es lo mismo. NO ES LO MISMO (que nadie diga nada de ninguna canción por favor, es un momento triste en mi vida)


Ella es mi personaje favorito: un trabajo que envidio, un guardarropa que envidio, una colección de Manolos que envidio, un apartamento que envidio… y un final feliz que envidio como una perraca más que nada en el mundo.

“Busco un amor irracional, ridículo… surrealista… pasional… algo así como no poder vivir sin la otra persona”

Eso es lo que yo también quiero.

martes, 14 de junio de 2005

Andevé con la hipocresía, intolerancia y doble moral.

Tengo el día torcido, lo sé. Lo peor de todo es que ayer fue lunes y comenzó mejor que hoy, que es martes. Sé perfectamente que no lo he comenzado con buen pie, mejor dicho, con buen ojo, porque me he querido adecentar un poco y no ha habido manera de acertar con el rímel. Por más que lo he intentado no he podido arreglar el estropicio y he decidido que antes que parecerme a Marylin Manson prefería ir con el look cara lavada.

No sólo NO era suficiente mi sufrimiento porque Alonso tuviera que abandonar la carrera, no, sino que además, me pongo a leer las noticias esta mañana
y me encuentro con que al desteñío de Michael Jackson lo declaran inocente de TODOS (10 exactamente) los cargos por abusos a menores y pederastia. Desde luego a cualquiera le dejan ser padre y cualquiera con dinero puede tener un buen abogado sin escrúpulos. Es que encima me meo por la pata abajo de la risa cuando en su web intentan comparar esta sentencia como algo histórico, como por ejemplo: la caída del muro de Berlín o la liberación de Nelson Mandela. Alguien me quiere explicar qué repercusión causa esto en la historial mundial? Alguien ha dejado de morir? Alguien ha comido hoy? Alguien ha descubierto el tratamiento definitivo contra el Sida? A mí que me registren.


No es un poco sospechoso que 10 personas se hayan inventado la misma historia? Y no es por meter el dedo en la llaga, pero sinceramente, yo creo que este tío es culpable. MUY culpable. Pero bueno, esto es como en el caso de O. J. Simpson: la pasta manda. No?

Pero a parte de que, en mi opinión, me parezca culpable, es imbécil. Siendo un personaje tan conocido, cómo se te ocurre decir que compartes tu habitación con niños? Nadie se escandaliza por esta sentencia y sin embargo arman la de Cristo porque la hermana enseñó una teta? En qué clase de país vive esta gente?

Vale, es una pregunta tonta, para la cual tengo una respuesta estúpida: hablamos de EE.UU. cualquier cosa que ocurra es ilógica. En un país sin cultura con una serie de presidentes como han tenido… No tengo palabras.

Y llegamos a mi tema favorito del día. Que me tiene indignadísima, tremendamente cabreada y experimentando un crecimiento paranormal de mis uñas. Pues resulta que Pepe Mari y sus amiguitos apoyan la manifestación CONTRA la ley de matrimonios gays. Pero se puede saber de qué cojones va esta gente? Qué derecho se creen que tienen para negarle a nadie que se pueda casar con la persona que le dé la real gana? Es más, esta gente conoce el significado de la palabra “derecho”?

Gays y lesbianas no pagan los mismos impuestos? Pues entonces que tengan los mismos derechos coño, ya está bien de discriminar a la gente por sus diferencias!! Y qué si un hombre quiere casarse con otro hombre? Y qué si una mujer quiere casarse con otra mujer? Y qué si además quieren adoptar? Son peores personas?

Señores peperos y señoras peperas, me la suda si ustedes son unos intolerantes y fachas de mierda, pero ya va siendo hora de que se enteren de que Franco murió (por mucho que ustedes se empeñen en seguir financiando su “fundación” y enviarle flores a la tumba en el aniversario de su agradecida muerte), estamos en el siglo XXI y los gays no son monstruos. Si no lo son ustedes… cómo lo van a ser personas absolutamente NOR-MA-LES con la misma capacidad de amar que un hetero? A ustedes qué carajo les importa con quién se acuestan por las noches?


Escuchando: Gloria GAYnor – I will survive, Mónica Naranjo – Desátame, Barbra Streisand – Guilty, Fangoria – Retorciendo palabras de amor…

domingo, 12 de junio de 2005

30 años y en casa de papaíto y mamaíta.


Al final de la calle donde vivo, hay un solar híper grande en el que una constructora ha plantado sus banderolas y ha empezado a dividir el terreno para hacer sus casas.Se supone que serán edificios de 3-4 plantas como mucho y pisos de 1,2,3 ó 4 habitaciones. Rollo residencial, cada piso con su plaza de parking y todas esas cosas que quedan súper bien cuando dices que te compras una casa.


El caso es que ahí trabaja mi amiga Lilia, la que se casó en octubre, trabaja en esa promotora. Ayer fui a su casa después de trabajar para ver si me acompañaba a comprar las 4 cosillas que necesitaba para hacerme una tarta de cumpleaños. Porque como no tuve tarta, a pesar de que el día de mi cumple me deprime bastante, el hecho de no tener tarta, me deprime aún más.


Na, mientras se termina de vestir y tal, nos ponemos a hablar y le digo: "qué emoción, espero que me digan pronto algo sobre esos pisos, porque estoy deseando verlos y a lo mejor, si mis padres me dan su "aprobación" y si cuela, un poco de ayudita..."


Nos reímos y me dice que seguro que sí,que además, como no entregan las llaves hasta pasados 2 años, que así puedo ir pagando poco a poco cada mes y tengo que pedir menos al banco y bla bla bla....


No conseguí escuchar lo que me decía después porque... ESTÁ DE COÑA? 2 AÑOS? VA EN SERIO?... SE DA CUENTA DE QUE TENDRÉ 30 TACOS? ESA PROMOTORA SE DA CUENTA DE QUE VA A CONVERTIR UNA DE MIS PEORES PESADILLAS EN REALIDAD??


2 años... Acabo de cumplir 28... Qué va a ser de mí? Sólo de pensarlo, así por encima, intentando hacerme a la idea, ya estoy hiperventilando!


Y todavía no hay nada! Quiero decir, que lo único que hay es una lista de espera para recibir información, ya que todavía la súper constructora ésa sólo tiene la información y planos para uso interno antes de "hacerla pública". Cuánto tiempo va a pasar? 2, 3, 4... 8 meses antes de que se sepa si te van a cobrar 1 o los 2 pulmones de entrada?


QUÉ DEPRESIÓN!! Con 30 años y teniendo que depender de que mi papaíto y mi mamaíta.... y ya que estamos mi hermanito y su gominola entren o salgan, para yo poder invitar a mis amigas a cenar, o a ver una peli, incrustarme en bragas en el sofá sin preocuparme o tirarme a alguien sin tener que estar pendiente de la puta puerta!!


Es así de duro, toda mi vida social se centra en cualquier lado excepto en casa.


Ya que estoy, redondeo a los 32 años (no te jode) y así cumplo el tiempo máximo de la cuenta vivienda de los cojones. Ya qué más da, from lost to the river and here nothing happens.


Si me pega por suicidarme, será después del concierto de U2, pero tengo demasiado claro que esta situación no voy a poder soportarla mucho más tiempo. Y al 1º que se le ocurra decirme que soy una exagerada, le pago unas vacaciones de 2 semanas en mi cuarto conviviendo con mi madre y luego lo reviento a hostias.

sábado, 11 de junio de 2005

Sábado en la oficina...

Estoy tan aburrida esta mañana en la oficina, que me ha pegado por ver lo que decía mi HORRORóscopo. Decía tal que asinjjj...

"Hoy es un hermoso día para ti, en el cual serás altamente recompensada por tu naturaleza amable y sensual. El amor se acerca por tu camino, por lo tanto quédate a la expectativa para recibir lo que mereces. Expón tus sentimientos en vez de intentar esconderlos del mundo. Es muy posible que otras personas sientan de manera similar y se sentirán tranquilos al escuchar que no están solos."

Que el amor se acerca por mi camino... que esté a la expectativa... SÓLO ME FALTABA ESO! NO TE JODE? Menudo cabreo me acabo de pillar. Es que no tengo ya suficientes problemas?? No, ahora resulta que tengo que estar a la expectativa de que algún atontao decida fijarse en mí... No si ya lo decía ese sabio, el Señor Murphy: "Cuando las cosas van mal tienden a ir peor".

Pero vamos a ver, sería tan malo que yo me fijara en alguien y PLACA-PLACA!!... PIM-PAM-PUM!!... Listo, se acabó, caer rendido a mis pies y sanseacabó.

No, no, no, tengo que estar a la expectativa, cual cazador ávido de una presa... GGGRRRRRMMMMFFFFFFÑÑÑÑÑÑÑSSSS!! Así nacen los paranóicos, lo sabían ustedes videntes estúpidos???

Ahora mismo sólo estoy a la expectativa de cobrar el día 28. Es lo que más deseo que se cruce en mi camino... Amor... bah... eso ni paga mis facturas ni me da satisfacciones... Por su culpa aún arrastro el lastre de la no-correspondencia.

A todo esto, han quedado bastante claros mis sentimientos?? Alguien se siente como yo?? Para que luego se diga que no hago caso de estas cosas... por si acaso.

Escuchando: la pesada de Chaquira y el gordo de Alejandro Sanz con la porquería esa de canción que han hecho juntos... puto hilo musical de mierda.

viernes, 10 de junio de 2005

Por favor que llegue ya la hora de saliiiiiiiir


NE-CE-SI-TO COMER ALGUNA GUARRERÍA O MATARÉ A ALGUIEN!! He hecho un trato conmigo misma. Si me porto bien y no como ninguna guarrería (tipo chocolatina, galleta, helado) antes de las 20:30, que es cuando salgo, me daré un homenaje con unos Doritos, o unas patatas fritas del Burrikin o algún helado fantástico del Filippo.

Porque yo soy capaz de estarme toda la tarde engullendo. Y no es plan, que luego me pongo como una foca monje.

No soporto al "nuevo" de mi trabajo.


Sabéis de esas personas que intentan hacerse los súper simpáticos? Que tienen que tener la última palabra en absolutamente todo para hacerse notar? Y que encima es un puto entrometido? Si todas las respuestas a estas preguntas son afirmativas: os presento al "nuevo" de la ofi en la que trabajo.

Me encantaría llamarlo Queguaposoyquetipotengo... pero es que es muy largo, así que lo dejamos en "nuevo".

Para empezar, en las reuniones que se hacen cada mañana antes de nada, el tío, siendo nuevo, va y se sienta en MI sitio. Que está estratégicamente pensado en la mesa del director para responder YO al tlf. Pero no, me tengo que sentar en la puta esquina de forma que el cable del tlf atraviesa la mesa... y el tío, erre que erre. No se da por enterado el muy cutre.

Porque enciama es cutre. Vamos, que es que a parte de feo, es que se piensa que está fantástico con su camisa de manga corta y corbata con nudo "cortacirculación". Y ese corte de pelo... que parece que le han pasado una segadora por la cabeza coño!

Y es que encima va de guays, quiere hacerse el gracioso... y no tiene ni puta idea de cómo hacerlo. Vamos a ver, piltrafilla, sólo hace 1 semana que me conoces y ya te atreves a preguntarme si soy o no lesbiana?? (esto fue antes de lo del pakistaní ese) SÓLO PORQUE NO ESTOY TODO EL DÍA HABLANDO DE TÍOS?? Mira chaval, yo, al menos, no he tenido que recurrir a internet para encontrar pareja... PILTRAFA, QUE ERES UN PILTRAFA!! Que este coleguita ha sido camarero/tapiecero (con mucha honra) toda su vida y ahora se cree que por ser comercial inmobiliario es la pera limonera. Mira que te diga una cosita majo: las corbatas hay que saber elegirlas, combinarlas, anudarlas y llevarlas. TÚ no tienes ni pajolera idea.

Y es que encima, ayer que tuve el día libre... el tontolaba éste, se sentó en mi mesa. Bien, no pasa, no pasa nada, no resoples Mara... el chaval necesitaba un pc porque el otro lo usaba la otra comercial. Entonces, me pregunto yo, porque soy muy preguntona... POR QUÉ COJONES TIENE QUE DESORDENAR TODAS MIS COSAS?? Y encima tiene los cojones (hexagonales, nada de cuadrados) de desordenarme todo y luego decirme que soy una desordenada.

He tenido que contenerme muy mucho para no asesinarle tirándole bolis Bic desde mi mesa. Para que lo sepas, cacho de jilipollas, mis carpetas están ordenadas alfabéticamente y cada esquina de mi mesa está destinada a un sólo tipo de documentos. Pero claro, cómo lo vas a entender si ni siquiera te debes saber el puñetero alfabeto, SUBNORMAL!!

Y ya el colmo, la otra comercial, me pidió si le podía grabar el recopilatorio de la Kylie, que ella no tiene mucha idea. Los ordenadores e internet no se llevan bien con ella. Se lo traigo, con su carátula súper currada y todo. Me dice ella: "ostras, qué bien, porque el programilla ese tan famoso a nosotros nos va muy lento". Me disponía yo a decirle cómo tenía que configurarlo... y salta el otro: "pos vas a tener que cambiar varias cosas bla bla bla"

Tú eres tonto o es que estudias cada día un poco para superarte? No te ha dicho que no tiene ni puta idea de ordenadores? Que no te hagas el guay imbécil, que me pudreeeeeeeeeeee!!.

Oig y lo de hoy ya ha sido la polla: que resulta que ha estado como 3/4 de hora con el director flipándose de que cree que él estaría mucho mejor en el puesto de perito que en el de simple comercial.

No pienso decir nada porque si por casualidad me muerdo la lengua mientras escribo me muero envenenada... no sin antes escupir al "nuevo" para que se muera también. POR MARISABIDILLO!!

jueves, 9 de junio de 2005

Para ti...


SHIVER

I walk a mile with a smile
And I don't know
I don't care where I am
But I know it's alright

Jump the tracks
Can't get back
I don't know anyone around here
But I'm safe this time

'Cos when you
Tell me, Tell me, Tell me
Stupid things, like you do
Yes, I
Have to, have to, have to
Change the rules
I can't lose

Cause I shiver
I just break up
When I'm near you
It all gets out of hand
Yes I shiver
I get bent up
There's no way that
I know you'll understand

We talk and talk
'round it all
Who'd have thought
We'd end up here
But I'm feeling fine
In a rush
Never trust
You'll be there
If I'd only stop and take my time

'Cos with you
I'm running, running, running
Somewhere I can't get to
Yes I have to have to have to
Change the rules
I'm with you

Cause I shiver
I just break up
When I'm near you
It all gets out of hand
Yes I shiverI get bent up
There's no way that
I know you'll understand

What if you get off at the next stop
Would you just wave as I'm drifting off
If I never saw you again
Could I (could i)
keep all (all)
of this (of this)
Inside

Cause I shiver
I just break up
When I'm near you
It all gets out of hand
Yes I shiver
I get bent up
There's no way that
I know you'll understand

miércoles, 8 de junio de 2005

PERO QUE AGGGGGGGGGCO!!


Tenemos un cliente en la inmobiliaria en la que trabajo que es pakistaní o de por ahí, donde Cristo dio las 4 voces, y a parte que el tío va de guays y nos pide una mega piso, con ascensor, 3 habitaciones dobles, un salón que parezca un campo de fútbol y una cocina amueblada, equipada y que quepa la paellera de los del Fairy... por 120.000€. Atentos al coleguita.

No sólo no quiere gastarse los 10.000€ que tiene ahorrados (toma Jeroma pastillas de goma) y quiere una financiación al 100% con gastos, muebles y posibles reformas incluídas sino que nos dice que: esa pasta no se la puede gastar en la casa porque están destinados a "comprarse" una mujer.

CÓMORRRRRRRR???

Que sí, que sí, que el pisha este ha ahorrado esa pasta para volverse a su pueblo y ofrecersela al primer padre jilipollas que lo quiera. Para eso quiere comprarse aquí el palacio, para vivir como un puto rey... con criada y todo. Viva la igualdad de sexos, ole y ole!.

TÓCATE LOS PIES MARISOFI!.

Y lo peor de todo esto es que encima, cada vez que entra, echa un vistazo a todas las féminas que aquí trabajamos. Y como resulta que mis otras 2 compis están casadas, el tío me viene atacando. Pero quién coño se ha creído que es? Tú en que puto país te crees que vives atontao? Anda, tira que encima voy a tener que pegarte una paliza.

Pos no me viene preguntando si estoy soltera, que si sé cocinar... la madre que lo trajo. No me cagué en toloquesemenea y en tosusmuertos porque no quiero ser una pedazo de bruta, que una es muy digna y puede responder de forma más elegante e hirientemente. Po'jemplo: "Soy lesbiana, se me entiende?". Tuve que hacerlo a la manera de la Esteban, que parece ser que es el único tipo de español que entiende.

Mira, tío estúpido: estoy soltera, sí que sé cocinar... pero ni quiero ser tu esclava, ni ser una máquina de hacer tus niños y mucho menos te pienses que con 10.000€ vas a poder comprarme. Que soy como el caviar iraníiiiiiiiii... o el jamón ibéricooooooooooo... o las putas angulas en navidaaaaaaaaaaaad!! y tu sólo tienes pa las chanclas que uso para ir a la playaaaaaaaaaa!

Por le Halcón Milenario!! QUE AAAAAAAAAAGGGGGGGGGCO!!

martes, 7 de junio de 2005

De momento me han felicitado...

Miguel Ángel
Saruki
Mi mamá
Mi papá
Lilia y Miguel
Toniojo
Moni
Mis compañeros de trabajo
Mi hermano
La novia de mi hermano
Vane
La Bruja
El Tete
Rakele...

Snif snif snif ya sé que me deprime mucho cumplir años pero... ESO ES TODO AMIGOS???... NADIE MÁS SE VA A ACORDAR DE MÍ???...

Y ya he recibido mis regalitos jijiji: la novia de mi hermano, Carmen (la gominola niña) unos pendientes de plata con cositas azules muy monos, mi mamá uno de mis perfumes favoritos el de Lolita Lempicka y un bolsito con flores lilas. Pero el regalo estrella... oig EL REGALO!!... Mi hermano: la edición especial de "El Señor de los anillos" que además incluye "El Hobbit" y "El Silmarillion".

Por fiiiiiiiiiiiiiiiiin!! Cada vez que me han preguntado lo que me gustaría por navidad o por mi cumple desde pequeña era esto: piezas de Lego (que siempre eran para mi hermano), el libro de "El Señor de los anillos", un peluche de Gizmo (el gremlin bueno) y... esto me da un poco de vergüenza pero... os acordáis de aquel juego que se llamaba "Diseña la moda"?. El sueño de mi vida de siempre fue ser diseñadora... ains!.

De momento, mi hermano ya ha cumplido... y Pablito (Kaster como le conocí jeje), un ex-chati, también, que me regaló a Gizmo. Y con lo demás qué? No me puedo imaginar cumpliendo 40 y que alguien me regale una caja de Lego... po'jemplo.

Soy mayor... estoy mayor?

¡¡Quiero una tarta como estaaaaaaaaa!!




Soy muy mayor... YA soy muy mayor. Prince y Anna Kournikova son también mayores hoy (pero a la perraca ésta que le den morcillas, a ver si le salen arrugas de una puta vez coño! que no se puede estar así de buena eternamente)... snif snif snif... SOY MAYOOOOOOOOOOOOOOOORRRRRRRRRRR!!

Qué depresión más gorda me entra en mi cumpleaños. Y encima, como consuelo la tarta... que no te quita la depre, pero no puedes parar de comer... porque estás depre!!
Por la cobertura de mi Nokia, por qué a la gente le hace tanta gracia recordarte los años que cumples?? por quéeeeeeeeeeeeeee?? Si es que la gente es muy cruel, muy, muy cruel y desconsiderada. No tienen piedad de esta pobre persona de 1'50, que será pobre... pero con estilo.

También es el cumple de mi papá, así que desde aquí: FELIZ CUMPLEAÑOS PAPIIIIIII!!!!!

lunes, 6 de junio de 2005

Pareciera...

... que hoy (lunes, cómo no?) veo mi vida de una manera diferente, extraña, como expectadora, psicodélica... casi esquizofrénica. Veo mi pasado, presente y futuro... y no sé si me gusta.

Estoy completamente a favor del matrimonio entre católicos.


Estoy completamente a favor de permitir el matrimonio entre católicos. Me parece una injusticia y un error tratar de impedírselo. El catolicismo no es una enfermedad. Los católicos, pese a que a muchos no les gusten o les parezcan extraños, son personas normales y deben poseer los mismos derechos que los demás, como si fueran, por ejemplo, informáticos u homosexuales.

Soy consciente de que muchos comportamientos y rasgos de carácter de las personas católicas, como su actitud casi enfermiza hacia el sexo, pueden parecernos extraños a los demás. Sé que incluso, a veces, podrían esgrimirse argumentos de salubridad pública, como su peligroso y deliberado rechazo a los preservativos.

Sé también que muchas de sus costumbres, como la exhibición pública de imágenes de torturados, pueden incomodar a algunos. Pero esto, además de ser más una imagen mediática que una realidad, no es razón para impedirles el ejercicio del matrimonio. Algunos podrían argumentar que un matrimonio entre católicos no es un matrimonio real, porque para ellos es un ritual y un precepto religioso ante su dios, en lugar de una unión entre dos personas.

También, dado que los hijos fuera del matrimonio están gravemente condenados por la iglesia, algunos podrían considerar que permitir que los católicos se casen incrementará el número de matrimonios por "el qué dirán" o por la simple búsqueda de sexo (prohibido por su religión fuera del matrimonio), incrementando con ello la violencia en el hogar y las familias desestructuradas. Pero hay que recordar que esto no es algo que ocurra sólo en las familias católicas y que, dado que no podemos meternos en la cabeza de los demás, no debemos juzgar sus motivaciones.

Por otro lado, el decir que eso no es matrimonio y que debería ser llamado de otra forma, no es más que una forma un tanto ruín de desviar el debate a cuestiones semánticas que no vienen al caso. Aunque sea entre católicos, un matrimonio es un matrimonio, y una familia es una familia.

Y con esta alusión a la familia paso a otro tema candente del que mi opinión, espero, no resulte demasiado radical: también estoy a favor de permitir que los católicos adopten hijos. Algunos se escandalizarán ante una afirmación de este tipo. Es probable que alguno responda con exclamaciones del tipo de "¿Católicos adoptando hijos? ¡Esos niños podrían hacerse católicos!".
Veo ese tipo de críticas y respondo: si bien es cierto que los hijos de católicos tienen mucha mayor probabilidad de convertirse a su vez en católicos (al contrario que, por ejemplo, ocurre en la informática o la homosexualidad), ya he argumentado antes que los católicos son personas como los demás.

Pese a las opiniones de algunos y a los indicios, no hay pruebas evidentes de que unos padres católicos estén peor preparados para educar a un hijo, ni de que el ambiente religiosamente sesgado de un hogar católico sea una influencia negativa para el niño. Además, los tribunales de adopción juzgan cada caso individualmente, y es precisamente su labor determinar la idoneidad de los padres.

En definitiva, y pese a las opiniones de algunos sectores, creo que debería permitírseles también a los católicos tanto el matrimonio como la adopción.

Exactamente igual que a los informáticos y a los homosexuales.

(Gracias Xavi por enviarme este mail. No sabes lo que me he reído!)

Manías y rarezas.

Soy rara, lo sé, lo reconozco y qué quieres que te diga?... es que tú no tienes manías?.
  • Al levantarme, intento que el primer pie que pongo en el suelo sea el derecho. Científicamente comprobado que no sirve de nada (sobre todo si es lunes).
    Puedo comer los espaguetis sin cuchara, pero cuando como fuera si no uso una no me siento agusto (será porque soy un imán para las puñeteras manchas... o simplemente soy torpe).
  • Sí, en mi cuarto puede campar a sus anchas el desorden, pero los libros siempre están amontonados en perfectos montones (los que no me caben en las estanterías) o agrupados por autor (en las estanterías).
  • No tiro nunca mis revistas (Elle, Telva, Vogue, Glamour... no todo va a ser lectura culturizadora).
  • Siempre llevo mi cámara digital en el bolso, porque nunca se sabe.
  • Si no tengo un paquete de kleenex en la mesita de noche no puedo dormir: fijo que me da un ataque de estornudos nocturnos (a parte de los mañaneros).
  • Guardo todas las cajas de los zapatos que me compro (mi madre me va a matar).
    Sigo el mismo ritual en la ducha: pelo, cuerpo y cara.
  • Ritual mañanero: mirar al techo durante 5-10 min, ir al baño, lavarme los dientes y beber un vaso de agua en la cocina.
  • Ritual nocturno: leer mínimo 30 minutos para poder relajarme y poder dormir.
  • No puedo sentarme como las personas normales en el cine, siempre recojo las piernas y me como un Kinder Bueno (2 ó 3 ó 4, me encantan).
  • Me cuesta deshacerme de ciertas prendas de ropa. Y sé que nunca más en mi vida me volverán a caber... pero las guardo.
  • Con los zapatos me pasa lo mismo... estoy pensando en ir al rastro o algo así. A lo mejor me compran algo y me llega limpiar el coche en el "Paquidermo celeste".
  • No me gusta ver películas empezadas.
  • No me gustan las pizzas con las 3 "a": alcaparras, alcachofas y/o anchoas.
  • Si me gusta o me aficiono a algo, tengo la imperiosa necesidad de comprar todo lo relacionado con ese algo.
  • Puede haberme pasado una catástrofe... y siempre la contaré con humor retorcido.
  • Hay ciertos alimentos que no me gustan, pero siempre termino volviéndolos a probar... para seguir teniendo la certeza de que no me gustan.

Sé que tengo muchas más rarezas que manías, pero ahora mismo sólo se me ocurren esas.


Escucho: James Brown - Sex Machine... Este tío sí que sabía!!.

NOOOOOOOOOOO

Creí que todo había acabado, que había salido por fin de la pesadilla, que podría respirar tranquila por un tiempo... por lo menos hasta el año que bien. PUES NO!

Pero qué he hecho yo para merecerme esto?

Después del disgusto de la boda de mi prima... ahora resulta que mi amiga Vero me confirma que el 9 de septiembre se casa con su "pukis" por lo civil en Valldemosa. Pero se puede saber qué coño le ha dao a la gente por casarse últimamente? Joder que no me dan ni un respiro, andevé! Ya he ido a 3 bodas en menos de año y medio. Así cómo pretenden que ahorre? Que si compra trapitos, pelu, el regalo... la madre que me parió, que luego me dirán que gasto demasiado.

Ostras, si aún no he podido hacer el regalo de la última boda que fui porque me salen gastos de debajo del teclado. Este verano me tendré que dedicar forzosamente a la vida contemplativa... quicir: a contemplar cómo los demás se lo pasan de puta madre mientras yo me contento con estudiar para septiembre.

Que esa es otra. A mi edad... con lo mayor que estoy... que me podrían llamar Nemo porque tengo una memoria a corto plazo como la de un pez. Qué triste!

Ya con estas edades, yendo a bodas más sola que la una, en casa de mis padres, la carrera sin acabar y haciendo esfuerzos para recordar lo que hice ayer o lo que haré dentro de 5 minutos. ESTA ES LA VIDA QUE ME ESPERA?? Jooooooooooooooooo... a estas alturas, ilusa de mi en la juventud, ya debería tener mi casita y mi perro POR LO MENOS!

En finsssssssss, queda por delante un arduo trabajo de preparación de la boda. Yo acompañaré a Vero a buscar vestidos de novia y me encargaré de la despedida de soltera. Eso significa que buscaré un sitios divertido para cenar y que seré la encargada de entrar en el sex-shop de turno para comprar las tonterías que nos tengamos que poner. Creo que eso es lo que más me divierte... a lo mejor tengo suerte y Nacho Vidal ya ha sacado a la venta la réplica de su pene y me estupecfacta a la par que me extasia tanta grandiosidad infinita.

Mmmmmmmmmmm, cuánto costará?

Escuchando... nada, en mi cabeza todavía oigo el "NOOOOOOOOO"

Frase del día:

"El sexo es el único deporte que no se interrumpe si se corta la luz"

domingo, 5 de junio de 2005

Pero qué bueno!!


Supongo que muchos de vosotros habréis visto "Matrix". Tengo que decir que me encantaba esa peli... hasta que gracias a un ex novio le cogí más manía que a la ex-mEnestra pepera Ana Palacio. Por qué?... Si no vi la primera parte 437 veces, no la vi ni una. Y luego el jilipollas se quejaba de que había visto demasiadas veces "Star Wars". La leche que t'han dao majo! Así te quedaste: viviendo en tu mundo de fantasía.

Menos mal Keanu Reeves está güenísimo que sinó...

Bueno, a lo que iba. Hace tiempo me llegó un sketch de un programa de japos, que este de verdad, es un programa de culto. No me digáis que no habéis visto el "Ping pong Matrix" porque se inaudito. Ahí os dejo el enlace y luego me decís:

Jaaaaaaaaaaaaaarrrrrrrrrrrrrl lo bueno que es. Pero es que luego, si buscas por ahí, encuentras otros de una mesa de billar donde las bolas son las cabezas de los japonesitos con cascos de colores, una ambientación de una viñeta de cómic donde ponen las interrogantes y los bocadillos con los pensamientos del personaje, la creación de un sandwich... bueno, bueno, bueno... en 5 palabras: im-pre-sio-nan-te!.

Oyesss, que incluso el programa tiene sus ganadores con copichuela como trofeo y tó Mari! Eso sí que podríamos importarlo a España y no la estupidez de "La Granja". O esperábamos tener otra Paris Hilton a la española? (no me podría imaginar a la hija de la Preysler ordeñando una vaca ni habiendo consumido drogas duras en un after-hours neeeeeeeeeeeeeng).

Pos ná, que resulta que a los Pet Shop Boy también les mola el programa y han puesto varias secuencias de dicho programa en su último vídeo, titulado "Flamboyant". Buenisisisisisisíiiiiiiiiiiiimo!!

Escuchando: pues eso, Pet Shop Boy - Flamboyant, que no es mi grupo favorito, pero alguna cancioncilla sí que me gusta.

viernes, 3 de junio de 2005

Preguntas tontas, ¿respuestas idiotas?

  • Por qué cuando terminas de pintarte las uñas alguien llama al tlf o a la puerta, de forma que alguna se te estropea?
  • Por qué Mecano era un grupo tan horroroso en los 80 y ahora casi el 90% de la población dice ser fan suyo?
  • Por qué cuando la Pe dijo eso de "Pedroooooooo" en los Óscar se dijo que era una ordinaria y cuando lo hizo Sofía Loren con Roberto Benigni quedó como un guiño patriota?
  • Por qué nadie se molesta en decirle a los de Miss España que es imposible ganar aunque sea el primer premio por traje regional mientras sigan teniendo un diseñador con el mismo sentido estético que Marujita Díaz?
  • Alguien, que no sea la Obregón, ve "Ana y los siete?
  • Es más, a quién pretende engañar "la bióloga" diciendo que es una idea original suya? Alguien ha visto alguna vez la serie norteamericana "Nanny" protagonizada por Fran Dreschner? Curiosamente va de un viudo mega rico con 3 hijos, mayordormo, una petarda que quiere casarse con él y bla bla bla...
  • Y, por cierto, alguien ve tan mal que el personaje de esta pava muera POR FIN?
  • Realmente pensábamos ganar con esas 3 pardas que enviamos a Eurovisión?
  • Por qué cuando sales de la pelu con un corte que se supone que es fácil de peinar, luego eres incapaz de mantener?
  • En serio, alguien más odia la canción de Shakira y Alejandro Sanz?
  • Después de tantos años, por qué los guiris siguen llevando chanclas con calcetines?
  • Por qué los anuncios de cremas, anticelutícos y demás potingues milagrosos siempre los hacen tias que no los necesitan?
  • Quién coño compra los productos de la Teletienda?
  • Quién cojones tiene la mente tan enferma como para inventar esos trastos y pretender que alguien se los compre?
  • Por qué algunos gitanos que van de pobres viviendo en chabolas... luego tiene unos Mercedacos de la muerte aparcados en la puerta?
  • Y por qué los que más pasta tienen, son los que luego más te ratean cuando van a comprar?
  • Por qué la gente tiene el rostro de pedirte siempre un descuento o un regalo cada vez que te compra algo, aunque sea un chicle?
  • Si en los portales se ponen buzones especiales para la publicidad, perfectamente visibles, por qué los chinos siguen llamando al puto portero a la hora de la siesta un sábado o domingo?
  • Por qué los hombres dicen que a ellos lo que les gustan son las chicas normales, inteligentes y morenas y luego babean por una Barbie, tonta y rubia? Bueno, el color del pelo es indiferente, pero siempre es de esa mayoría de guapas tontas.
  • Por qué los anuncios de detergentes todavía los siguen haciendo mujeres?
  • Cómo es posible que para anunciar un horno tenga que salir una mujer que es piloto? Qué pasa, que después de 14 horas de vuelo tiene que ir corriendo a casa a hacerle un súper asado a su maridito y 6 hijos?
  • Por favor, que alguien mate a los publicistas de Grupo Pascual, nadie les ha comentado lo horrorosos que son sus anuncios?
  • Y retomando el tema de los hornos: si sale una mujer maquillándose usando la puerta de un horno como espejo mientras éste se limpia... existe la versión masculina de un tío cortándose los pelillos de la nariz?
  • Acabará el programa de mi adorado Buenafuente convirtiéndose en el horror que es Crónicas Marcianas?
  • Quién se ofrece voluntario para torturar hasta la muerte al estilista de Mariah Carey? Se ha dado cuenta de que esas cejas le quedan como el culo, entre otras muchas cosas?

Pues nada, ahí dejo las preguntas en el aire... a ver si alguien me las responde. Si se me ocurren más ya las iré poniendo.

Mentalmente (porque en el curro tengo el puto hilo musical de los webs): Wet wet wet - Love is all around.

miércoles, 1 de junio de 2005

Os acordáis de cuando...


... yo reté a la dama llamada suerte a que si nuestra actual Miss españa llegaba a Miss Universo y la 1º dama de honor a Miss Mundo a que me encontrara un tipo con el que quisiera casarme?

Todo gracias a un comentario de la Bruja jejeje. Eh, eh? después de haber leído el post y los comentarios os acordáis??

Si ya lo dije yo que era IM-PO-SI-BLEEEEE, pero si era más fácil llevar a Déborah Ombres al concurso, que por lo menos es más auténtica y asume que es plana (y tiene pene).

Así que como esta pava no ha llegado a Miss Universo, la Dama Fortuna ya poco puede hacer, ha perdido estrepitosamente. Y es que esta vez lo tenía un rato chungo la pobre... uy qué penaaaaaaaaaaaaa! jajaja.

pd: anda que tiene cojones! Gana Canadá cuya representante ni siquiera es de allí. Asi que es como si hubiera ganado Rusia, en vez de Canadá. No hay reinado latino este año.

SÍ, SÍ, SÍIIIIIIIIIIII


No, no es que esté teniendo un orgasmo... y mucho menos al saber que súper Nacho Vidal se retira. Que amoavé, a mí me da lo mismo, porque el chaval es más feo que el feo de los hermanos Calatrava comiendo limón, pero ese cuerpo... ese saber hacer... esa... ejem... carisma... grande, grande, grande...

Uff qué caloresssssssssss!

Que no, que no, que lo que me da a mí esta alegría es que por fin me han arreglado el coche y lo voy a recoger en media hora. SÍIIIIIIIIIIIIIII!! Hecho de menos conducir, poner la música que me dé la gana y poner a parir a todo conductor masculino que se me cruce con chulería por ser yo una mujer. Sí, una mujer, pero te vas a cagar mamón! Que te piensas que me vas a adelantar sin poner el intermitente porque tú lo vales.

Pos pa chula yo y pa puta tu prima! Nos ha jodío el tontolaba este?