miércoles, 8 de junio de 2005

PERO QUE AGGGGGGGGGCO!!


Tenemos un cliente en la inmobiliaria en la que trabajo que es pakistaní o de por ahí, donde Cristo dio las 4 voces, y a parte que el tío va de guays y nos pide una mega piso, con ascensor, 3 habitaciones dobles, un salón que parezca un campo de fútbol y una cocina amueblada, equipada y que quepa la paellera de los del Fairy... por 120.000€. Atentos al coleguita.

No sólo no quiere gastarse los 10.000€ que tiene ahorrados (toma Jeroma pastillas de goma) y quiere una financiación al 100% con gastos, muebles y posibles reformas incluídas sino que nos dice que: esa pasta no se la puede gastar en la casa porque están destinados a "comprarse" una mujer.

CÓMORRRRRRRR???

Que sí, que sí, que el pisha este ha ahorrado esa pasta para volverse a su pueblo y ofrecersela al primer padre jilipollas que lo quiera. Para eso quiere comprarse aquí el palacio, para vivir como un puto rey... con criada y todo. Viva la igualdad de sexos, ole y ole!.

TÓCATE LOS PIES MARISOFI!.

Y lo peor de todo esto es que encima, cada vez que entra, echa un vistazo a todas las féminas que aquí trabajamos. Y como resulta que mis otras 2 compis están casadas, el tío me viene atacando. Pero quién coño se ha creído que es? Tú en que puto país te crees que vives atontao? Anda, tira que encima voy a tener que pegarte una paliza.

Pos no me viene preguntando si estoy soltera, que si sé cocinar... la madre que lo trajo. No me cagué en toloquesemenea y en tosusmuertos porque no quiero ser una pedazo de bruta, que una es muy digna y puede responder de forma más elegante e hirientemente. Po'jemplo: "Soy lesbiana, se me entiende?". Tuve que hacerlo a la manera de la Esteban, que parece ser que es el único tipo de español que entiende.

Mira, tío estúpido: estoy soltera, sí que sé cocinar... pero ni quiero ser tu esclava, ni ser una máquina de hacer tus niños y mucho menos te pienses que con 10.000€ vas a poder comprarme. Que soy como el caviar iraníiiiiiiiii... o el jamón ibéricooooooooooo... o las putas angulas en navidaaaaaaaaaaaad!! y tu sólo tienes pa las chanclas que uso para ir a la playaaaaaaaaaa!

Por le Halcón Milenario!! QUE AAAAAAAAAAGGGGGGGGGCO!!

5 comentarios:

El Tete dijo...

Ande luego, parece mentira que haya gente así... Lo gracioso no es que se casen con varias, lo gracioso es que las COMPREN.

Un amigo mío fue con su novia este verano a Egipto y hubo no que quiso comprársela por no sé cuántos camellos.

Vaya mundo...

Renko dijo...

ooostieeeesss... perdóneme usted por no haberme dado cuenta antes debido a mis obligaciones de estudiante universitario en periodo de exámenes (osigui, que llevo tres semanas viviendo en La Riera)....

FELICIDADES POR TU CUMPLEEEEEE!! OEOEOEOEOE FELISITATS!! ERES GEMINIS COMO YO!!! OEEEEEOEOEOEOE

:) UN BESO ENORRRRME

Mons dijo...

Felicidades por tu cumpleaños! ;-**

Y es verdad, todavía existe la esclavitud en todas sus miserables formas en este mundo.
Besos

Bruja del Norte dijo...

todavía existen muchos tipos de esclavitud desgraciadamente, y ese tipo, la de la mujer esclava también se da en nuestra sociedad de otra manera, pero se da, sobre todo antes. No le daban dinero al padre para comprarle la hija pero a cambio de un buen matrimonio y de mantenerla toda la vida esperaban una sumisa ama de casa, buena cocinera y puta en la cama...

te funcionó lo de la lesbi?? o le puso más al tío?

Mara Jade dijo...

Sirvió lo de lesbi, me miró como si fuera un ser antinatural... que bien pensado: pos jamía, una tiene un no sé qué q la hace eso, antinatural jajaja.

Pero aún así, cdo entra por la oficina me echa un vistazo por siaca. Mientras no toque, q mire lo q dé la real gana!